Incidental Mutation 'R7974:Adamts9'
ID 650771
Institutional Source Beutler Lab
Gene Symbol Adamts9
Ensembl Gene ENSMUSG00000030022
Gene Name ADAM metallopeptidase with thrombospondin type 1 motif 9
Synonyms Mhdaund3, Mhdaund4, 1810011L16Rik, 8430403M15Rik, E030027K14Rik, Gsfund3, UND3, UND4
MMRRC Submission 046017-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R7974 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 92749680-92920473 bp(-) (GRCm39)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 92886668 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000109065 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113438]
AlphaFold E9PUN6
Predicted Effect probably null
Transcript: ENSMUST00000113438
SMART Domains Protein: ENSMUSP00000109065
Gene: ENSMUSG00000030022

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:Pep_M12B_propep 49 207 1.8e-37 PFAM
low complexity region 234 247 N/A INTRINSIC
Pfam:Reprolysin_5 291 476 7.6e-17 PFAM
Pfam:Reprolysin_4 291 495 2e-11 PFAM
Pfam:Reprolysin 293 499 7.4e-29 PFAM
Pfam:Reprolysin_2 310 489 1e-13 PFAM
Pfam:Reprolysin_3 314 445 1.7e-14 PFAM
TSP1 591 643 2.15e-9 SMART
Pfam:ADAM_spacer1 753 871 7.3e-35 PFAM
TSP1 881 936 1.14e0 SMART
Blast:TSP1 938 993 2e-28 BLAST
TSP1 1000 1054 3.78e-5 SMART
TSP1 1055 1109 5.64e-4 SMART
TSP1 1110 1166 1.25e-5 SMART
TSP1 1186 1240 1.45e-6 SMART
TSP1 1242 1296 4.41e-6 SMART
TSP1 1328 1380 7.06e-5 SMART
TSP1 1381 1436 4.24e-8 SMART
TSP1 1440 1495 8.23e-6 SMART
TSP1 1496 1551 1.23e-4 SMART
TSP1 1552 1609 2e-4 SMART
TSP1 1611 1672 1.25e-5 SMART
TSP1 1676 1730 3.47e-4 SMART
Pfam:GON 1732 1930 1.6e-85 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (64/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ADAMTS (a disintegrin and metalloproteinase with thrombospondin motifs) protein family. Members of the family share several distinct protein modules, including a propeptide region, a metalloproteinase domain, a disintegrin-like domain, and a thrombospondin type 1 (TS) motif. Individual members of this family differ in the number of C-terminal TS motifs, and some have unique C-terminal domains. Members of the ADAMTS family have been implicated in the cleavage of proteoglycans, the control of organ shape during development, and the inhibition of angiogenesis. This gene is localized to chromosome 3p14.3-p14.2, an area known to be lost in hereditary renal tumors. Alternative splicing results in multiple transcript variants encoding different isoforms that may undergo similar proteolytic processing. [provided by RefSeq, Jan 2016]
PHENOTYPE: Homozygous null mice display embryonic lethality before somite formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim1 C T 19: 57,033,405 (GRCm39) probably null Het
Adamts19 A T 18: 59,144,094 (GRCm39) Q892L possibly damaging Het
Aftph T C 11: 20,648,233 (GRCm39) *686W probably null Het
AI661453 T C 17: 47,777,006 (GRCm39) L244P unknown Het
Ankar C A 1: 72,738,138 (GRCm39) E15* probably null Het
Ankrd39 A G 1: 36,585,999 (GRCm39) probably benign Het
Arsi A G 18: 61,045,478 (GRCm39) D56G probably damaging Het
Blmh T C 11: 76,856,729 (GRCm39) I245T possibly damaging Het
Ccr6 T C 17: 8,475,056 (GRCm39) F87S probably damaging Het
Cdc42ep2 T C 19: 5,968,523 (GRCm39) K61E probably damaging Het
Celsr1 C T 15: 85,915,231 (GRCm39) G914D probably damaging Het
Cep126 T A 9: 8,120,764 (GRCm39) K86N probably benign Het
Cfap70 A T 14: 20,470,818 (GRCm39) F532I probably damaging Het
Cpsf3 T A 12: 21,358,006 (GRCm39) L506Q probably damaging Het
Dct A C 14: 118,277,067 (GRCm39) I273S probably damaging Het
Dsel T C 1: 111,788,229 (GRCm39) I769V probably benign Het
Dus2 G A 8: 106,762,652 (GRCm39) E138K probably benign Het
Emsy A G 7: 98,279,425 (GRCm39) S305P possibly damaging Het
Erp27 A T 6: 136,885,063 (GRCm39) V245D probably damaging Het
Fez1 C A 9: 36,755,244 (GRCm39) T81K probably damaging Het
Gli3 A C 13: 15,900,841 (GRCm39) Q1409H probably benign Het
Hdac9 T C 12: 34,353,219 (GRCm39) S664G possibly damaging Het
Hibadh A G 6: 52,534,880 (GRCm39) S167P probably benign Het
Hsdl1 A G 8: 120,293,072 (GRCm39) V121A probably benign Het
Ift70a1 T C 2: 75,810,688 (GRCm39) H465R probably damaging Het
Ighv1-18 A C 12: 114,646,669 (GRCm39) I6S possibly damaging Het
Iqcm T A 8: 76,281,520 (GRCm39) M1K probably null Het
Itch T C 2: 155,034,079 (GRCm39) F417S probably damaging Het
Itpr1 C T 6: 108,500,366 (GRCm39) T2653I possibly damaging Het
Kank1 T G 19: 25,401,584 (GRCm39) Y1064D probably damaging Het
Kmt2c T C 5: 25,505,561 (GRCm39) Q3249R probably damaging Het
Lefty1 T C 1: 180,765,385 (GRCm39) C318R probably damaging Het
Lmbr1l C T 15: 98,809,500 (GRCm39) V147I probably benign Het
Meig1 C A 2: 3,412,911 (GRCm39) E37* probably null Het
Mpp3 A G 11: 101,899,180 (GRCm39) probably null Het
Muc17 T C 5: 137,175,664 (GRCm39) N2S Het
Mup7 T C 4: 60,067,518 (GRCm39) E199G possibly damaging Het
Nol4 G C 18: 22,852,082 (GRCm39) Y275* probably null Het
Nrxn1 G A 17: 91,008,207 (GRCm39) P429S probably damaging Het
Or14j8 T C 17: 38,263,672 (GRCm39) Y81C probably damaging Het
Pfkl A T 10: 77,829,996 (GRCm39) F367L probably damaging Het
Pik3cg T C 12: 32,254,031 (GRCm39) E652G probably benign Het
Prkag3 A G 1: 74,783,980 (GRCm39) I301T probably benign Het
Rcn1 G A 2: 105,224,055 (GRCm39) P163L probably benign Het
Slc1a7 G A 4: 107,869,473 (GRCm39) V513M probably benign Het
Slc37a2 A T 9: 37,150,421 (GRCm39) probably null Het
Slc9b1 C T 3: 135,099,791 (GRCm39) T437I possibly damaging Het
Smap1 T G 1: 23,888,522 (GRCm39) T248P probably benign Het
Smpd3 A C 8: 106,982,254 (GRCm39) C617G probably benign Het
Spata20 T C 11: 94,374,966 (GRCm39) N212S possibly damaging Het
Sphkap A C 1: 83,256,683 (GRCm39) C355W probably damaging Het
Spopfm2 T C 3: 94,082,848 (GRCm39) K321R probably benign Het
Spsb1 T A 4: 149,991,566 (GRCm39) M1L probably damaging Het
Srebf2 C T 15: 82,062,966 (GRCm39) R468C probably damaging Het
Stxbp5 A C 10: 9,646,439 (GRCm39) probably null Het
Taar5 G C 10: 23,847,120 (GRCm39) D173H possibly damaging Het
Tfrc A G 16: 32,440,101 (GRCm39) D438G probably null Het
Tinag A T 9: 76,907,131 (GRCm39) I368K probably benign Het
Tm9sf1 A G 14: 55,873,906 (GRCm39) W531R probably damaging Het
Tnc G T 4: 63,918,961 (GRCm39) P1154Q possibly damaging Het
Toporsl A G 4: 52,611,645 (GRCm39) R513G probably damaging Het
Vat1 A G 11: 101,356,956 (GRCm39) S2P probably benign Het
Vmn2r107 C G 17: 20,577,270 (GRCm39) P423A probably benign Het
Vmn2r2 T A 3: 64,024,808 (GRCm39) E591V probably damaging Het
Vmn2r62 T A 7: 42,437,281 (GRCm39) Y401F probably damaging Het
Vmn2r62 G A 7: 42,414,031 (GRCm39) T804I probably damaging Het
Vmn2r89 A T 14: 51,693,459 (GRCm39) I270F probably damaging Het
Zfp418 T C 7: 7,185,167 (GRCm39) F377L possibly damaging Het
Zkscan5 T C 5: 145,144,502 (GRCm39) S182P unknown Het
Other mutations in Adamts9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00565:Adamts9 APN 6 92,836,883 (GRCm39) missense possibly damaging 0.90
IGL01352:Adamts9 APN 6 92,837,155 (GRCm39) missense probably benign 0.00
IGL01462:Adamts9 APN 6 92,871,247 (GRCm39) missense probably benign 0.04
IGL01551:Adamts9 APN 6 92,784,001 (GRCm39) missense probably damaging 0.99
IGL01577:Adamts9 APN 6 92,835,128 (GRCm39) splice site probably benign
IGL01638:Adamts9 APN 6 92,849,409 (GRCm39) missense probably benign 0.19
IGL01757:Adamts9 APN 6 92,773,140 (GRCm39) missense probably damaging 1.00
IGL02102:Adamts9 APN 6 92,754,420 (GRCm39) missense probably benign 0.00
IGL02379:Adamts9 APN 6 92,774,014 (GRCm39) missense probably damaging 0.97
IGL02419:Adamts9 APN 6 92,773,978 (GRCm39) missense probably benign 0.04
IGL02554:Adamts9 APN 6 92,857,828 (GRCm39) missense probably benign 0.01
IGL02832:Adamts9 APN 6 92,784,156 (GRCm39) missense probably damaging 1.00
IGL03164:Adamts9 APN 6 92,866,918 (GRCm39) missense probably damaging 1.00
IGL03347:Adamts9 APN 6 92,864,413 (GRCm39) nonsense probably null
IGL03401:Adamts9 APN 6 92,763,849 (GRCm39) missense probably damaging 0.97
basilisk UTSW 6 92,837,170 (GRCm39) missense probably benign 0.35
bluebeard UTSW 6 92,856,940 (GRCm39) nonsense probably null
Serpent UTSW 6 92,885,687 (GRCm39) missense probably damaging 1.00
PIT4402001:Adamts9 UTSW 6 92,849,328 (GRCm39) missense probably benign
PIT4458001:Adamts9 UTSW 6 92,866,886 (GRCm39) missense probably damaging 0.99
R0047:Adamts9 UTSW 6 92,882,287 (GRCm39) unclassified probably benign
R0047:Adamts9 UTSW 6 92,882,287 (GRCm39) unclassified probably benign
R0067:Adamts9 UTSW 6 92,867,148 (GRCm39) missense probably damaging 0.98
R0141:Adamts9 UTSW 6 92,920,066 (GRCm39) missense probably benign
R0326:Adamts9 UTSW 6 92,835,038 (GRCm39) nonsense probably null
R0396:Adamts9 UTSW 6 92,774,986 (GRCm39) missense probably benign 0.00
R0490:Adamts9 UTSW 6 92,849,847 (GRCm39) missense probably benign
R0504:Adamts9 UTSW 6 92,889,626 (GRCm39) missense probably damaging 1.00
R0620:Adamts9 UTSW 6 92,835,094 (GRCm39) missense possibly damaging 0.95
R0669:Adamts9 UTSW 6 92,857,938 (GRCm39) missense probably damaging 1.00
R0682:Adamts9 UTSW 6 92,880,783 (GRCm39) missense possibly damaging 0.80
R1412:Adamts9 UTSW 6 92,773,414 (GRCm39) missense probably benign
R1433:Adamts9 UTSW 6 92,826,271 (GRCm39) critical splice donor site probably null
R1558:Adamts9 UTSW 6 92,885,692 (GRCm39) missense possibly damaging 0.87
R1661:Adamts9 UTSW 6 92,857,604 (GRCm39) missense possibly damaging 0.92
R1801:Adamts9 UTSW 6 92,840,357 (GRCm39) missense probably benign 0.27
R1855:Adamts9 UTSW 6 92,878,350 (GRCm39) splice site probably benign
R1887:Adamts9 UTSW 6 92,849,769 (GRCm39) critical splice donor site probably null
R1934:Adamts9 UTSW 6 92,920,102 (GRCm39) missense possibly damaging 0.59
R1956:Adamts9 UTSW 6 92,836,830 (GRCm39) missense probably damaging 1.00
R1986:Adamts9 UTSW 6 92,773,375 (GRCm39) missense probably benign
R2370:Adamts9 UTSW 6 92,837,184 (GRCm39) missense probably damaging 0.99
R2376:Adamts9 UTSW 6 92,889,812 (GRCm39) missense probably benign
R2432:Adamts9 UTSW 6 92,834,881 (GRCm39) missense probably damaging 1.00
R2876:Adamts9 UTSW 6 92,772,891 (GRCm39) splice site probably benign
R3015:Adamts9 UTSW 6 92,849,913 (GRCm39) missense probably benign 0.05
R3611:Adamts9 UTSW 6 92,846,965 (GRCm39) missense probably benign 0.05
R4024:Adamts9 UTSW 6 92,849,765 (GRCm39) splice site probably benign
R4292:Adamts9 UTSW 6 92,772,977 (GRCm39) missense possibly damaging 0.95
R4403:Adamts9 UTSW 6 92,836,845 (GRCm39) missense probably damaging 1.00
R4574:Adamts9 UTSW 6 92,856,940 (GRCm39) nonsense probably null
R4677:Adamts9 UTSW 6 92,793,587 (GRCm39) start codon destroyed probably null
R5114:Adamts9 UTSW 6 92,867,254 (GRCm39) missense probably benign 0.03
R5260:Adamts9 UTSW 6 92,784,118 (GRCm39) missense probably benign 0.00
R5384:Adamts9 UTSW 6 92,774,999 (GRCm39) missense probably damaging 1.00
R5423:Adamts9 UTSW 6 92,857,678 (GRCm39) missense possibly damaging 0.84
R5497:Adamts9 UTSW 6 92,831,346 (GRCm39) missense probably damaging 1.00
R5629:Adamts9 UTSW 6 92,775,114 (GRCm39) missense probably damaging 1.00
R5943:Adamts9 UTSW 6 92,880,767 (GRCm39) missense probably benign 0.02
R6039:Adamts9 UTSW 6 92,885,527 (GRCm39) missense possibly damaging 0.95
R6039:Adamts9 UTSW 6 92,885,527 (GRCm39) missense possibly damaging 0.95
R6051:Adamts9 UTSW 6 92,867,099 (GRCm39) missense probably damaging 1.00
R6051:Adamts9 UTSW 6 92,836,907 (GRCm39) missense possibly damaging 0.83
R6082:Adamts9 UTSW 6 92,866,930 (GRCm39) missense probably damaging 1.00
R6192:Adamts9 UTSW 6 92,774,002 (GRCm39) missense probably damaging 1.00
R6291:Adamts9 UTSW 6 92,867,101 (GRCm39) missense probably damaging 1.00
R6502:Adamts9 UTSW 6 92,849,316 (GRCm39) missense probably damaging 1.00
R6818:Adamts9 UTSW 6 92,882,172 (GRCm39) missense probably damaging 1.00
R6848:Adamts9 UTSW 6 92,840,335 (GRCm39) missense possibly damaging 0.84
R7028:Adamts9 UTSW 6 92,886,774 (GRCm39) nonsense probably null
R7095:Adamts9 UTSW 6 92,864,672 (GRCm39) missense probably benign 0.39
R7287:Adamts9 UTSW 6 92,866,984 (GRCm39) missense possibly damaging 0.89
R7294:Adamts9 UTSW 6 92,871,270 (GRCm39) missense probably damaging 1.00
R7313:Adamts9 UTSW 6 92,835,102 (GRCm39) missense probably damaging 1.00
R7581:Adamts9 UTSW 6 92,914,319 (GRCm39) missense probably benign 0.00
R7682:Adamts9 UTSW 6 92,857,679 (GRCm39) missense possibly damaging 0.57
R7691:Adamts9 UTSW 6 92,773,219 (GRCm39) missense probably damaging 1.00
R7791:Adamts9 UTSW 6 92,849,366 (GRCm39) missense probably benign 0.00
R7851:Adamts9 UTSW 6 92,885,687 (GRCm39) missense probably damaging 1.00
R8224:Adamts9 UTSW 6 92,773,351 (GRCm39) missense probably damaging 0.96
R8328:Adamts9 UTSW 6 92,866,993 (GRCm39) missense probably benign 0.17
R8334:Adamts9 UTSW 6 92,914,225 (GRCm39) splice site probably null
R8559:Adamts9 UTSW 6 92,784,117 (GRCm39) missense probably benign 0.01
R8709:Adamts9 UTSW 6 92,784,144 (GRCm39) missense probably damaging 1.00
R8735:Adamts9 UTSW 6 92,837,048 (GRCm39) intron probably benign
R8739:Adamts9 UTSW 6 92,831,261 (GRCm39) missense probably benign 0.04
R9108:Adamts9 UTSW 6 92,857,721 (GRCm39) missense probably damaging 1.00
R9171:Adamts9 UTSW 6 92,849,381 (GRCm39) missense probably benign 0.03
R9198:Adamts9 UTSW 6 92,837,170 (GRCm39) missense probably benign 0.35
R9299:Adamts9 UTSW 6 92,773,976 (GRCm39) missense probably benign 0.00
R9300:Adamts9 UTSW 6 92,864,371 (GRCm39) missense probably benign 0.10
R9308:Adamts9 UTSW 6 92,857,875 (GRCm39) missense probably benign 0.03
R9325:Adamts9 UTSW 6 92,849,279 (GRCm39) missense probably benign 0.00
R9397:Adamts9 UTSW 6 92,878,444 (GRCm39) missense probably damaging 1.00
R9550:Adamts9 UTSW 6 92,878,429 (GRCm39) missense probably benign 0.00
R9623:Adamts9 UTSW 6 92,857,661 (GRCm39) missense probably benign 0.02
R9698:Adamts9 UTSW 6 92,784,121 (GRCm39) missense probably damaging 1.00
R9755:Adamts9 UTSW 6 92,856,922 (GRCm39) missense probably benign 0.15
RF013:Adamts9 UTSW 6 92,920,126 (GRCm39) missense possibly damaging 0.88
Z1177:Adamts9 UTSW 6 92,831,327 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCACATGCAGCAGTGTTTGG -3'
(R):5'- CCGAAATGGCATATCTAATTGGTG -3'

Sequencing Primer
(F):5'- CTACTTGTGTGTAGTGAACAGAGGC -3'
(R):5'- GTTGTTGCATAGACCAAGAGCACTTC -3'
Posted On 2020-09-15