Mutagenetix > Incidental Mutation

Incidental Mutation 'R7974:Adamts9'

650771

Institutional Source

Beutler Lab

Gene Symbol

Adamts9

Ensembl Gene

ENSMUSG00000030022

Gene Name

a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 9

Synonyms

8430403M15Rik, E030027K14Rik, 1810011L16Rik

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R7974 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

92772699-92943492 bp(-) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

A to G at 92909687 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000109065 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000113438]

AlphaFold

E9PUN6

Predicted Effect

probably null
Transcript: ENSMUST00000113438

SMART Domains

Protein: ENSMUSP00000109065
Gene: ENSMUSG00000030022

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
Pfam:Pep_M12B_propep	49	207	1.8e-37	PFAM
low complexity region	234	247	N/A	INTRINSIC
Pfam:Reprolysin_5	291	476	7.6e-17	PFAM
Pfam:Reprolysin_4	291	495	2e-11	PFAM
Pfam:Reprolysin	293	499	7.4e-29	PFAM
Pfam:Reprolysin_2	310	489	1e-13	PFAM
Pfam:Reprolysin_3	314	445	1.7e-14	PFAM
TSP1	591	643	2.15e-9	SMART
Pfam:ADAM_spacer1	753	871	7.3e-35	PFAM
TSP1	881	936	1.14e0	SMART
Blast:TSP1	938	993	2e-28	BLAST
TSP1	1000	1054	3.78e-5	SMART
TSP1	1055	1109	5.64e-4	SMART
TSP1	1110	1166	1.25e-5	SMART
TSP1	1186	1240	1.45e-6	SMART
TSP1	1242	1296	4.41e-6	SMART
TSP1	1328	1380	7.06e-5	SMART
TSP1	1381	1436	4.24e-8	SMART
TSP1	1440	1495	8.23e-6	SMART
TSP1	1496	1551	1.23e-4	SMART
TSP1	1552	1609	2e-4	SMART
TSP1	1611	1672	1.25e-5	SMART
TSP1	1676	1730	3.47e-4	SMART
Pfam:GON	1732	1930	1.6e-85	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

100% (64/64)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ADAMTS (a disintegrin and metalloproteinase with thrombospondin motifs) protein family. Members of the family share several distinct protein modules, including a propeptide region, a metalloproteinase domain, a disintegrin-like domain, and a thrombospondin type 1 (TS) motif. Individual members of this family differ in the number of C-terminal TS motifs, and some have unique C-terminal domains. Members of the ADAMTS family have been implicated in the cleavage of proteoglycans, the control of organ shape during development, and the inhibition of angiogenesis. This gene is localized to chromosome 3p14.3-p14.2, an area known to be lost in hereditary renal tumors. Alternative splicing results in multiple transcript variants encoding different isoforms that may undergo similar proteolytic processing. [provided by RefSeq, Jan 2016]
PHENOTYPE: Homozygous null mice display embryonic lethality before somite formation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 69 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ablim1	C	T	19: 57,044,973		probably null	Het
Adamts19	A	T	18: 59,011,022	Q892L	possibly damaging	Het
Aftph	T	C	11: 20,698,233	*686W	probably null	Het
AI661453	T	C	17: 47,466,081	L244P	unknown	Het
Ankar	C	A	1: 72,698,979	E15*	probably null	Het
Ankrd39	A	G	1: 36,546,918		probably benign	Het
Arsi	A	G	18: 60,912,406	D56G	probably damaging	Het
Blmh	T	C	11: 76,965,903	I245T	possibly damaging	Het
Ccr6	T	C	17: 8,256,224	F87S	probably damaging	Het
Cdc42ep2	T	C	19: 5,918,495	K61E	probably damaging	Het
Celsr1	C	T	15: 86,031,030	G914D	probably damaging	Het
Cep126	T	A	9: 8,120,763	K86N	probably benign	Het
Cfap70	A	T	14: 20,420,750	F532I	probably damaging	Het
Cpsf3	T	A	12: 21,308,005	L506Q	probably damaging	Het
Dct	A	C	14: 118,039,655	I273S	probably damaging	Het
Dsel	T	C	1: 111,860,499	I769V	probably benign	Het
Dus2	G	A	8: 106,036,020	E138K	probably benign	Het
Emsy	A	G	7: 98,630,218	S305P	possibly damaging	Het
Erp27	A	T	6: 136,908,065	V245D	probably damaging	Het
Fez1	C	A	9: 36,843,948	T81K	probably damaging	Het
Gli3	A	C	13: 15,726,256	Q1409H	probably benign	Het
Gm10696	T	C	3: 94,175,541	K321R	probably benign	Het
Hdac9	T	C	12: 34,303,220	S664G	possibly damaging	Het
Hibadh	A	G	6: 52,557,895	S167P	probably benign	Het
Hsdl1	A	G	8: 119,566,333	V121A	probably benign	Het
Ighv1-18	A	C	12: 114,683,049	I6S	possibly damaging	Het
Iqcm	T	A	8: 75,554,892	M1K	probably null	Het
Itch	T	C	2: 155,192,159	F417S	probably damaging	Het
Itpr1	C	T	6: 108,523,405	T2653I	possibly damaging	Het
Kank1	T	G	19: 25,424,220	Y1064D	probably damaging	Het
Kmt2c	T	C	5: 25,300,563	Q3249R	probably damaging	Het
Lefty1	T	C	1: 180,937,820	C318R	probably damaging	Het
Lmbr1l	C	T	15: 98,911,619	V147I	probably benign	Het
Meig1	C	A	2: 3,411,874	E37*	probably null	Het
Mpp3	A	G	11: 102,008,354		probably null	Het
Muc3	T	C	5: 137,146,816	N2S		Het
Mup7	T	C	4: 60,067,518	E199G	possibly damaging	Het
Nol4	G	C	18: 22,719,025	Y275*	probably null	Het
Nrxn1	G	A	17: 90,700,779	P429S	probably damaging	Het
Olfr761	T	C	17: 37,952,781	Y81C	probably damaging	Het
Pfkl	A	T	10: 77,994,162	F367L	probably damaging	Het
Pik3cg	T	C	12: 32,204,032	E652G	probably benign	Het
Prkag3	A	G	1: 74,744,821	I301T	probably benign	Het
Rcn1	G	A	2: 105,393,710	P163L	probably benign	Het
Slc1a7	G	A	4: 108,012,276	V513M	probably benign	Het
Slc37a2	A	T	9: 37,239,125		probably null	Het
Slc9b1	C	T	3: 135,394,030	T437I	possibly damaging	Het
Smap1	T	G	1: 23,849,441	T248P	probably benign	Het
Smpd3	A	C	8: 106,255,622	C617G	probably benign	Het
Spata20	T	C	11: 94,484,140	N212S	possibly damaging	Het
Sphkap	A	C	1: 83,278,962	C355W	probably damaging	Het
Spsb1	T	A	4: 149,907,109	M1L	probably damaging	Het
Srebf2	C	T	15: 82,178,765	R468C	probably damaging	Het
Stxbp5	A	C	10: 9,770,695		probably null	Het
Taar5	G	C	10: 23,971,222	D173H	possibly damaging	Het
Tfrc	A	G	16: 32,621,283	D438G	probably null	Het
Tinag	A	T	9: 76,999,849	I368K	probably benign	Het
Tm9sf1	A	G	14: 55,636,449	W531R	probably damaging	Het
Tnc	G	T	4: 64,000,724	P1154Q	possibly damaging	Het
Toporsl	A	G	4: 52,611,645	R513G	probably damaging	Het
Ttc30a1	T	C	2: 75,980,344	H465R	probably damaging	Het
Vat1	A	G	11: 101,466,130	S2P	probably benign	Het
Vmn2r107	C	G	17: 20,357,008	P423A	probably benign	Het
Vmn2r2	T	A	3: 64,117,387	E591V	probably damaging	Het
Vmn2r62	G	A	7: 42,764,607	T804I	probably damaging	Het
Vmn2r62	T	A	7: 42,787,857	Y401F	probably damaging	Het
Vmn2r89	A	T	14: 51,456,002	I270F	probably damaging	Het
Zfp418	T	C	7: 7,182,168	F377L	possibly damaging	Het
Zkscan5	T	C	5: 145,207,692	S182P	unknown	Het

Other mutations in Adamts9

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00565:Adamts9	APN	6	92859902	missense	possibly damaging	0.90
IGL01352:Adamts9	APN	6	92860174	missense	probably benign	0.00
IGL01462:Adamts9	APN	6	92894266	missense	probably benign	0.04
IGL01551:Adamts9	APN	6	92807020	missense	probably damaging	0.99
IGL01577:Adamts9	APN	6	92858147	splice site	probably benign
IGL01638:Adamts9	APN	6	92872428	missense	probably benign	0.19
IGL01757:Adamts9	APN	6	92796159	missense	probably damaging	1.00
IGL02102:Adamts9	APN	6	92777439	missense	probably benign	0.00
IGL02379:Adamts9	APN	6	92797033	missense	probably damaging	0.97
IGL02419:Adamts9	APN	6	92796997	missense	probably benign	0.04
IGL02554:Adamts9	APN	6	92880847	missense	probably benign	0.01
IGL02832:Adamts9	APN	6	92807175	missense	probably damaging	1.00
IGL03164:Adamts9	APN	6	92889937	missense	probably damaging	1.00
IGL03347:Adamts9	APN	6	92887432	nonsense	probably null
IGL03401:Adamts9	APN	6	92786868	missense	probably damaging	0.97
basilisk	UTSW	6	92860189	missense	probably benign	0.35
bluebeard	UTSW	6	92879959	nonsense	probably null
Serpent	UTSW	6	92908706	missense	probably damaging	1.00
PIT4402001:Adamts9	UTSW	6	92872347	missense	probably benign
PIT4458001:Adamts9	UTSW	6	92889905	missense	probably damaging	0.99
R0047:Adamts9	UTSW	6	92905306	unclassified	probably benign
R0047:Adamts9	UTSW	6	92905306	unclassified	probably benign
R0067:Adamts9	UTSW	6	92890167	missense	probably damaging	0.98
R0141:Adamts9	UTSW	6	92943085	missense	probably benign
R0326:Adamts9	UTSW	6	92858057	nonsense	probably null
R0396:Adamts9	UTSW	6	92798005	missense	probably benign	0.00
R0490:Adamts9	UTSW	6	92872866	missense	probably benign
R0504:Adamts9	UTSW	6	92912645	missense	probably damaging	1.00
R0620:Adamts9	UTSW	6	92858113	missense	possibly damaging	0.95
R0669:Adamts9	UTSW	6	92880957	missense	probably damaging	1.00
R0682:Adamts9	UTSW	6	92903802	missense	possibly damaging	0.80
R1412:Adamts9	UTSW	6	92796433	missense	probably benign
R1433:Adamts9	UTSW	6	92849290	critical splice donor site	probably null
R1558:Adamts9	UTSW	6	92908711	missense	possibly damaging	0.87
R1661:Adamts9	UTSW	6	92880623	missense	possibly damaging	0.92
R1801:Adamts9	UTSW	6	92863376	missense	probably benign	0.27
R1855:Adamts9	UTSW	6	92901369	splice site	probably benign
R1887:Adamts9	UTSW	6	92872788	critical splice donor site	probably null
R1934:Adamts9	UTSW	6	92943121	missense	possibly damaging	0.59
R1956:Adamts9	UTSW	6	92859849	missense	probably damaging	1.00
R1986:Adamts9	UTSW	6	92796394	missense	probably benign
R2370:Adamts9	UTSW	6	92860203	missense	probably damaging	0.99
R2376:Adamts9	UTSW	6	92912831	missense	probably benign
R2432:Adamts9	UTSW	6	92857900	missense	probably damaging	1.00
R2876:Adamts9	UTSW	6	92795910	splice site	probably benign
R3015:Adamts9	UTSW	6	92872932	missense	probably benign	0.05
R3611:Adamts9	UTSW	6	92869984	missense	probably benign	0.05
R4024:Adamts9	UTSW	6	92872784	splice site	probably benign
R4292:Adamts9	UTSW	6	92795996	missense	possibly damaging	0.95
R4403:Adamts9	UTSW	6	92859864	missense	probably damaging	1.00
R4574:Adamts9	UTSW	6	92879959	nonsense	probably null
R4677:Adamts9	UTSW	6	92816606	start codon destroyed	probably null
R5114:Adamts9	UTSW	6	92890273	missense	probably benign	0.03
R5260:Adamts9	UTSW	6	92807137	missense	probably benign	0.00
R5384:Adamts9	UTSW	6	92798018	missense	probably damaging	1.00
R5423:Adamts9	UTSW	6	92880697	missense	possibly damaging	0.84
R5497:Adamts9	UTSW	6	92854365	missense	probably damaging	1.00
R5629:Adamts9	UTSW	6	92798133	missense	probably damaging	1.00
R5943:Adamts9	UTSW	6	92903786	missense	probably benign	0.02
R6039:Adamts9	UTSW	6	92908546	missense	possibly damaging	0.95
R6039:Adamts9	UTSW	6	92908546	missense	possibly damaging	0.95
R6051:Adamts9	UTSW	6	92859926	missense	possibly damaging	0.83
R6051:Adamts9	UTSW	6	92890118	missense	probably damaging	1.00
R6082:Adamts9	UTSW	6	92889949	missense	probably damaging	1.00
R6192:Adamts9	UTSW	6	92797021	missense	probably damaging	1.00
R6291:Adamts9	UTSW	6	92890120	missense	probably damaging	1.00
R6502:Adamts9	UTSW	6	92872335	missense	probably damaging	1.00
R6818:Adamts9	UTSW	6	92905191	missense	probably damaging	1.00
R6848:Adamts9	UTSW	6	92863354	missense	possibly damaging	0.84
R7028:Adamts9	UTSW	6	92909793	nonsense	probably null
R7095:Adamts9	UTSW	6	92887691	missense	probably benign	0.39
R7287:Adamts9	UTSW	6	92890003	missense	possibly damaging	0.89
R7294:Adamts9	UTSW	6	92894289	missense	probably damaging	1.00
R7313:Adamts9	UTSW	6	92858121	missense	probably damaging	1.00
R7581:Adamts9	UTSW	6	92937338	missense	probably benign	0.00
R7682:Adamts9	UTSW	6	92880698	missense	possibly damaging	0.57
R7691:Adamts9	UTSW	6	92796238	missense	probably damaging	1.00
R7791:Adamts9	UTSW	6	92872385	missense	probably benign	0.00
R7851:Adamts9	UTSW	6	92908706	missense	probably damaging	1.00
R8224:Adamts9	UTSW	6	92796370	missense	probably damaging	0.96
R8328:Adamts9	UTSW	6	92890012	missense	probably benign	0.17
R8334:Adamts9	UTSW	6	92937244	splice site	probably null
R8559:Adamts9	UTSW	6	92807136	missense	probably benign	0.01
R8709:Adamts9	UTSW	6	92807163	missense	probably damaging	1.00
R8735:Adamts9	UTSW	6	92860067	intron	probably benign
R8739:Adamts9	UTSW	6	92854280	missense	probably benign	0.04
R9108:Adamts9	UTSW	6	92880740	missense	probably damaging	1.00
R9171:Adamts9	UTSW	6	92872400	missense	probably benign	0.03
R9198:Adamts9	UTSW	6	92860189	missense	probably benign	0.35
R9299:Adamts9	UTSW	6	92796995	missense	probably benign	0.00
R9300:Adamts9	UTSW	6	92887390	missense	probably benign	0.10
R9308:Adamts9	UTSW	6	92880894	missense	probably benign	0.03
R9325:Adamts9	UTSW	6	92872298	missense	probably benign	0.00
R9397:Adamts9	UTSW	6	92901463	missense	probably damaging	1.00
R9550:Adamts9	UTSW	6	92901448	missense	probably benign	0.00
R9623:Adamts9	UTSW	6	92880680	missense	probably benign	0.02
R9698:Adamts9	UTSW	6	92807140	missense	probably damaging	1.00
R9755:Adamts9	UTSW	6	92879941	missense	probably benign	0.15
RF013:Adamts9	UTSW	6	92943145	missense	possibly damaging	0.88
Z1177:Adamts9	UTSW	6	92854346	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- GCACATGCAGCAGTGTTTGG -3'
(R):5'- CCGAAATGGCATATCTAATTGGTG -3'

Sequencing Primer
(F):5'- CTACTTGTGTGTAGTGAACAGAGGC -3'
(R):5'- GTTGTTGCATAGACCAAGAGCACTTC -3'

Posted On

2020-09-15