Incidental Mutation 'R7974:Emsy'
ID 650777
Institutional Source Beutler Lab
Gene Symbol Emsy
Ensembl Gene ENSMUSG00000035401
Gene Name EMSY, BRCA2-interacting transcriptional repressor
Synonyms 2210018M11Rik
MMRRC Submission 046017-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.520) question?
Stock # R7974 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 98236344-98305990 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 98279425 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 305 (S305P)
Ref Sequence ENSEMBL: ENSMUSP00000145858 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038359] [ENSMUST00000205276] [ENSMUST00000205911] [ENSMUST00000206611] [ENSMUST00000206619]
AlphaFold Q8BMB0
Predicted Effect unknown
Transcript: ENSMUST00000038359
AA Change: S305P
SMART Domains Protein: ENSMUSP00000038216
Gene: ENSMUSG00000035401
AA Change: S305P

DomainStartEndE-ValueType
ENT 16 88 2.44e-29 SMART
low complexity region 94 104 N/A INTRINSIC
low complexity region 124 142 N/A INTRINSIC
low complexity region 226 248 N/A INTRINSIC
low complexity region 293 331 N/A INTRINSIC
low complexity region 363 406 N/A INTRINSIC
low complexity region 527 540 N/A INTRINSIC
low complexity region 542 557 N/A INTRINSIC
low complexity region 681 698 N/A INTRINSIC
low complexity region 807 816 N/A INTRINSIC
low complexity region 866 882 N/A INTRINSIC
low complexity region 893 909 N/A INTRINSIC
low complexity region 1197 1208 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000205276
AA Change: S305P

PolyPhen 2 Score 0.734 (Sensitivity: 0.85; Specificity: 0.92)
Predicted Effect possibly damaging
Transcript: ENSMUST00000205911
AA Change: S266P

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect probably benign
Transcript: ENSMUST00000206611
Predicted Effect possibly damaging
Transcript: ENSMUST00000206619
AA Change: S291P

PolyPhen 2 Score 0.734 (Sensitivity: 0.85; Specificity: 0.92)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (64/64)
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim1 C T 19: 57,033,405 (GRCm39) probably null Het
Adamts19 A T 18: 59,144,094 (GRCm39) Q892L possibly damaging Het
Adamts9 A G 6: 92,886,668 (GRCm39) probably null Het
Aftph T C 11: 20,648,233 (GRCm39) *686W probably null Het
AI661453 T C 17: 47,777,006 (GRCm39) L244P unknown Het
Ankar C A 1: 72,738,138 (GRCm39) E15* probably null Het
Ankrd39 A G 1: 36,585,999 (GRCm39) probably benign Het
Arsi A G 18: 61,045,478 (GRCm39) D56G probably damaging Het
Blmh T C 11: 76,856,729 (GRCm39) I245T possibly damaging Het
Ccr6 T C 17: 8,475,056 (GRCm39) F87S probably damaging Het
Cdc42ep2 T C 19: 5,968,523 (GRCm39) K61E probably damaging Het
Celsr1 C T 15: 85,915,231 (GRCm39) G914D probably damaging Het
Cep126 T A 9: 8,120,764 (GRCm39) K86N probably benign Het
Cfap70 A T 14: 20,470,818 (GRCm39) F532I probably damaging Het
Cpsf3 T A 12: 21,358,006 (GRCm39) L506Q probably damaging Het
Dct A C 14: 118,277,067 (GRCm39) I273S probably damaging Het
Dsel T C 1: 111,788,229 (GRCm39) I769V probably benign Het
Dus2 G A 8: 106,762,652 (GRCm39) E138K probably benign Het
Erp27 A T 6: 136,885,063 (GRCm39) V245D probably damaging Het
Fez1 C A 9: 36,755,244 (GRCm39) T81K probably damaging Het
Gli3 A C 13: 15,900,841 (GRCm39) Q1409H probably benign Het
Hdac9 T C 12: 34,353,219 (GRCm39) S664G possibly damaging Het
Hibadh A G 6: 52,534,880 (GRCm39) S167P probably benign Het
Hsdl1 A G 8: 120,293,072 (GRCm39) V121A probably benign Het
Ift70a1 T C 2: 75,810,688 (GRCm39) H465R probably damaging Het
Ighv1-18 A C 12: 114,646,669 (GRCm39) I6S possibly damaging Het
Iqcm T A 8: 76,281,520 (GRCm39) M1K probably null Het
Itch T C 2: 155,034,079 (GRCm39) F417S probably damaging Het
Itpr1 C T 6: 108,500,366 (GRCm39) T2653I possibly damaging Het
Kank1 T G 19: 25,401,584 (GRCm39) Y1064D probably damaging Het
Kmt2c T C 5: 25,505,561 (GRCm39) Q3249R probably damaging Het
Lefty1 T C 1: 180,765,385 (GRCm39) C318R probably damaging Het
Lmbr1l C T 15: 98,809,500 (GRCm39) V147I probably benign Het
Meig1 C A 2: 3,412,911 (GRCm39) E37* probably null Het
Mpp3 A G 11: 101,899,180 (GRCm39) probably null Het
Muc17 T C 5: 137,175,664 (GRCm39) N2S Het
Mup7 T C 4: 60,067,518 (GRCm39) E199G possibly damaging Het
Nol4 G C 18: 22,852,082 (GRCm39) Y275* probably null Het
Nrxn1 G A 17: 91,008,207 (GRCm39) P429S probably damaging Het
Or14j8 T C 17: 38,263,672 (GRCm39) Y81C probably damaging Het
Pfkl A T 10: 77,829,996 (GRCm39) F367L probably damaging Het
Pik3cg T C 12: 32,254,031 (GRCm39) E652G probably benign Het
Prkag3 A G 1: 74,783,980 (GRCm39) I301T probably benign Het
Rcn1 G A 2: 105,224,055 (GRCm39) P163L probably benign Het
Slc1a7 G A 4: 107,869,473 (GRCm39) V513M probably benign Het
Slc37a2 A T 9: 37,150,421 (GRCm39) probably null Het
Slc9b1 C T 3: 135,099,791 (GRCm39) T437I possibly damaging Het
Smap1 T G 1: 23,888,522 (GRCm39) T248P probably benign Het
Smpd3 A C 8: 106,982,254 (GRCm39) C617G probably benign Het
Spata20 T C 11: 94,374,966 (GRCm39) N212S possibly damaging Het
Sphkap A C 1: 83,256,683 (GRCm39) C355W probably damaging Het
Spopfm2 T C 3: 94,082,848 (GRCm39) K321R probably benign Het
Spsb1 T A 4: 149,991,566 (GRCm39) M1L probably damaging Het
Srebf2 C T 15: 82,062,966 (GRCm39) R468C probably damaging Het
Stxbp5 A C 10: 9,646,439 (GRCm39) probably null Het
Taar5 G C 10: 23,847,120 (GRCm39) D173H possibly damaging Het
Tfrc A G 16: 32,440,101 (GRCm39) D438G probably null Het
Tinag A T 9: 76,907,131 (GRCm39) I368K probably benign Het
Tm9sf1 A G 14: 55,873,906 (GRCm39) W531R probably damaging Het
Tnc G T 4: 63,918,961 (GRCm39) P1154Q possibly damaging Het
Toporsl A G 4: 52,611,645 (GRCm39) R513G probably damaging Het
Vat1 A G 11: 101,356,956 (GRCm39) S2P probably benign Het
Vmn2r107 C G 17: 20,577,270 (GRCm39) P423A probably benign Het
Vmn2r2 T A 3: 64,024,808 (GRCm39) E591V probably damaging Het
Vmn2r62 T A 7: 42,437,281 (GRCm39) Y401F probably damaging Het
Vmn2r62 G A 7: 42,414,031 (GRCm39) T804I probably damaging Het
Vmn2r89 A T 14: 51,693,459 (GRCm39) I270F probably damaging Het
Zfp418 T C 7: 7,185,167 (GRCm39) F377L possibly damaging Het
Zkscan5 T C 5: 145,144,502 (GRCm39) S182P unknown Het
Other mutations in Emsy
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01314:Emsy APN 7 98,242,662 (GRCm39) missense probably benign 0.09
IGL01357:Emsy APN 7 98,240,077 (GRCm39) nonsense probably null
IGL01620:Emsy APN 7 98,275,831 (GRCm39) missense probably damaging 1.00
IGL01750:Emsy APN 7 98,268,508 (GRCm39) missense probably damaging 0.99
IGL02032:Emsy APN 7 98,239,987 (GRCm39) missense possibly damaging 0.94
IGL02388:Emsy APN 7 98,290,873 (GRCm39) missense probably damaging 0.99
IGL03089:Emsy APN 7 98,286,473 (GRCm39) nonsense probably null
IGL03272:Emsy APN 7 98,242,969 (GRCm39) missense probably damaging 0.98
IGL03347:Emsy APN 7 98,259,892 (GRCm39) missense probably damaging 0.99
IGL03400:Emsy APN 7 98,251,933 (GRCm39) missense possibly damaging 0.94
IGL02980:Emsy UTSW 7 98,268,587 (GRCm39) missense probably damaging 0.97
R0576:Emsy UTSW 7 98,242,983 (GRCm39) missense probably damaging 0.99
R1102:Emsy UTSW 7 98,251,796 (GRCm39) missense probably damaging 0.97
R1323:Emsy UTSW 7 98,259,864 (GRCm39) splice site probably benign
R1438:Emsy UTSW 7 98,270,613 (GRCm39) missense possibly damaging 0.88
R1439:Emsy UTSW 7 98,250,048 (GRCm39) intron probably benign
R1452:Emsy UTSW 7 98,249,881 (GRCm39) missense probably damaging 0.96
R1515:Emsy UTSW 7 98,240,063 (GRCm39) missense probably damaging 1.00
R1535:Emsy UTSW 7 98,242,944 (GRCm39) missense possibly damaging 0.94
R1791:Emsy UTSW 7 98,297,087 (GRCm39) missense probably damaging 0.99
R1829:Emsy UTSW 7 98,251,937 (GRCm39) missense possibly damaging 0.88
R1829:Emsy UTSW 7 98,251,936 (GRCm39) missense possibly damaging 0.95
R1848:Emsy UTSW 7 98,250,028 (GRCm39) missense probably damaging 0.99
R1861:Emsy UTSW 7 98,290,822 (GRCm39) missense probably damaging 1.00
R1929:Emsy UTSW 7 98,275,830 (GRCm39) missense probably damaging 0.99
R1957:Emsy UTSW 7 98,297,027 (GRCm39) missense probably damaging 1.00
R2221:Emsy UTSW 7 98,239,982 (GRCm39) missense possibly damaging 0.83
R2223:Emsy UTSW 7 98,239,982 (GRCm39) missense possibly damaging 0.83
R2271:Emsy UTSW 7 98,275,830 (GRCm39) missense probably damaging 0.99
R4078:Emsy UTSW 7 98,239,932 (GRCm39) missense probably damaging 0.99
R4707:Emsy UTSW 7 98,246,311 (GRCm39) missense possibly damaging 0.94
R4783:Emsy UTSW 7 98,295,686 (GRCm39) missense possibly damaging 0.74
R5453:Emsy UTSW 7 98,250,013 (GRCm39) missense probably damaging 0.97
R5518:Emsy UTSW 7 98,242,818 (GRCm39) missense possibly damaging 0.86
R5828:Emsy UTSW 7 98,242,699 (GRCm39) missense probably benign
R5945:Emsy UTSW 7 98,268,590 (GRCm39) missense probably damaging 0.97
R6153:Emsy UTSW 7 98,260,060 (GRCm39) missense probably damaging 1.00
R6824:Emsy UTSW 7 98,242,614 (GRCm39) missense probably benign 0.27
R7068:Emsy UTSW 7 98,259,968 (GRCm39) missense probably benign 0.17
R7381:Emsy UTSW 7 98,240,010 (GRCm39) missense probably damaging 0.98
R7417:Emsy UTSW 7 98,264,693 (GRCm39) missense probably damaging 1.00
R7488:Emsy UTSW 7 98,264,762 (GRCm39) missense possibly damaging 0.94
R7499:Emsy UTSW 7 98,279,538 (GRCm39) missense possibly damaging 0.59
R7646:Emsy UTSW 7 98,268,560 (GRCm39) missense probably damaging 1.00
R7682:Emsy UTSW 7 98,239,905 (GRCm39) missense probably damaging 0.99
R7716:Emsy UTSW 7 98,248,973 (GRCm39) missense unknown
R7789:Emsy UTSW 7 98,270,696 (GRCm39) missense probably damaging 1.00
R7794:Emsy UTSW 7 98,249,931 (GRCm39) missense probably benign 0.30
R7832:Emsy UTSW 7 98,289,060 (GRCm39) missense probably damaging 1.00
R7996:Emsy UTSW 7 98,242,888 (GRCm39) missense probably benign 0.00
R8070:Emsy UTSW 7 98,275,922 (GRCm39) missense possibly damaging 0.73
R8221:Emsy UTSW 7 98,297,111 (GRCm39) missense probably damaging 1.00
R8472:Emsy UTSW 7 98,304,037 (GRCm39) start gained probably benign
R8841:Emsy UTSW 7 98,264,768 (GRCm39) missense possibly damaging 0.95
R8998:Emsy UTSW 7 98,268,512 (GRCm39) missense possibly damaging 0.63
R9063:Emsy UTSW 7 98,295,684 (GRCm39) missense probably damaging 0.96
R9259:Emsy UTSW 7 98,242,757 (GRCm39) missense probably benign
R9366:Emsy UTSW 7 98,290,860 (GRCm39) missense probably benign 0.23
R9660:Emsy UTSW 7 98,262,285 (GRCm39) missense possibly damaging 0.95
R9729:Emsy UTSW 7 98,262,256 (GRCm39) missense probably benign 0.01
X0067:Emsy UTSW 7 98,279,447 (GRCm39) missense possibly damaging 0.65
Z1088:Emsy UTSW 7 98,249,929 (GRCm39) missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TGACCTAACAGCAGAGATCCTC -3'
(R):5'- ACCAAGTTCAACCTTTGTGCC -3'

Sequencing Primer
(F):5'- GAGATCCTCAACCCCAAGATAGG -3'
(R):5'- AGTTCAACCTTTGTGCCCAACATTC -3'
Posted On 2020-09-15