Incidental Mutation 'R7974:Fez1'
ID 650783
Institutional Source Beutler Lab
Gene Symbol Fez1
Ensembl Gene ENSMUSG00000032118
Gene Name fasciculation and elongation protein zeta 1
Synonyms zygin I, UNC76, UNC-76
MMRRC Submission 046017-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7974 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 36733160-36790220 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 36755244 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Lysine at position 81 (T81K)
Ref Sequence ENSEMBL: ENSMUSP00000034630 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034630] [ENSMUST00000161500] [ENSMUST00000162633] [ENSMUST00000163816] [ENSMUST00000214772]
AlphaFold Q8K0X8
Predicted Effect probably damaging
Transcript: ENSMUST00000034630
AA Change: T81K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000034630
Gene: ENSMUSG00000032118
AA Change: T81K

DomainStartEndE-ValueType
Pfam:FEZ 58 300 3.4e-96 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000160041
AA Change: T57K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000124648
Gene: ENSMUSG00000032118
AA Change: T57K

DomainStartEndE-ValueType
Pfam:FEZ 35 87 4.6e-19 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000161500
AA Change: T81K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000123762
Gene: ENSMUSG00000032118
AA Change: T81K

DomainStartEndE-ValueType
Pfam:FEZ 58 167 5.6e-38 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000162633
AA Change: T81K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124634
Gene: ENSMUSG00000032118
AA Change: T81K

DomainStartEndE-ValueType
Pfam:FEZ 58 123 6.3e-29 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000163816
AA Change: T81K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000126072
Gene: ENSMUSG00000032118
AA Change: T81K

DomainStartEndE-ValueType
Pfam:FEZ 58 297 2.7e-86 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214772
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (64/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is an ortholog of the C. elegans unc-76 gene, which is necessary for normal axonal bundling and elongation within axon bundles. Expression of this gene in C. elegans unc-76 mutants can restore to the mutants partial locomotion and axonal fasciculation, suggesting that it also functions in axonal outgrowth. The N-terminal half of the gene product is highly acidic. Alternatively spliced transcript variants encoding different isoforms of this protein have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit hyperactivity and increased sensitivity to methamphetamine. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim1 C T 19: 57,033,405 (GRCm39) probably null Het
Adamts19 A T 18: 59,144,094 (GRCm39) Q892L possibly damaging Het
Adamts9 A G 6: 92,886,668 (GRCm39) probably null Het
Aftph T C 11: 20,648,233 (GRCm39) *686W probably null Het
AI661453 T C 17: 47,777,006 (GRCm39) L244P unknown Het
Ankar C A 1: 72,738,138 (GRCm39) E15* probably null Het
Ankrd39 A G 1: 36,585,999 (GRCm39) probably benign Het
Arsi A G 18: 61,045,478 (GRCm39) D56G probably damaging Het
Blmh T C 11: 76,856,729 (GRCm39) I245T possibly damaging Het
Ccr6 T C 17: 8,475,056 (GRCm39) F87S probably damaging Het
Cdc42ep2 T C 19: 5,968,523 (GRCm39) K61E probably damaging Het
Celsr1 C T 15: 85,915,231 (GRCm39) G914D probably damaging Het
Cep126 T A 9: 8,120,764 (GRCm39) K86N probably benign Het
Cfap70 A T 14: 20,470,818 (GRCm39) F532I probably damaging Het
Cpsf3 T A 12: 21,358,006 (GRCm39) L506Q probably damaging Het
Dct A C 14: 118,277,067 (GRCm39) I273S probably damaging Het
Dsel T C 1: 111,788,229 (GRCm39) I769V probably benign Het
Dus2 G A 8: 106,762,652 (GRCm39) E138K probably benign Het
Emsy A G 7: 98,279,425 (GRCm39) S305P possibly damaging Het
Erp27 A T 6: 136,885,063 (GRCm39) V245D probably damaging Het
Gli3 A C 13: 15,900,841 (GRCm39) Q1409H probably benign Het
Hdac9 T C 12: 34,353,219 (GRCm39) S664G possibly damaging Het
Hibadh A G 6: 52,534,880 (GRCm39) S167P probably benign Het
Hsdl1 A G 8: 120,293,072 (GRCm39) V121A probably benign Het
Ift70a1 T C 2: 75,810,688 (GRCm39) H465R probably damaging Het
Ighv1-18 A C 12: 114,646,669 (GRCm39) I6S possibly damaging Het
Iqcm T A 8: 76,281,520 (GRCm39) M1K probably null Het
Itch T C 2: 155,034,079 (GRCm39) F417S probably damaging Het
Itpr1 C T 6: 108,500,366 (GRCm39) T2653I possibly damaging Het
Kank1 T G 19: 25,401,584 (GRCm39) Y1064D probably damaging Het
Kmt2c T C 5: 25,505,561 (GRCm39) Q3249R probably damaging Het
Lefty1 T C 1: 180,765,385 (GRCm39) C318R probably damaging Het
Lmbr1l C T 15: 98,809,500 (GRCm39) V147I probably benign Het
Meig1 C A 2: 3,412,911 (GRCm39) E37* probably null Het
Mpp3 A G 11: 101,899,180 (GRCm39) probably null Het
Muc17 T C 5: 137,175,664 (GRCm39) N2S Het
Mup7 T C 4: 60,067,518 (GRCm39) E199G possibly damaging Het
Nol4 G C 18: 22,852,082 (GRCm39) Y275* probably null Het
Nrxn1 G A 17: 91,008,207 (GRCm39) P429S probably damaging Het
Or14j8 T C 17: 38,263,672 (GRCm39) Y81C probably damaging Het
Pfkl A T 10: 77,829,996 (GRCm39) F367L probably damaging Het
Pik3cg T C 12: 32,254,031 (GRCm39) E652G probably benign Het
Prkag3 A G 1: 74,783,980 (GRCm39) I301T probably benign Het
Rcn1 G A 2: 105,224,055 (GRCm39) P163L probably benign Het
Slc1a7 G A 4: 107,869,473 (GRCm39) V513M probably benign Het
Slc37a2 A T 9: 37,150,421 (GRCm39) probably null Het
Slc9b1 C T 3: 135,099,791 (GRCm39) T437I possibly damaging Het
Smap1 T G 1: 23,888,522 (GRCm39) T248P probably benign Het
Smpd3 A C 8: 106,982,254 (GRCm39) C617G probably benign Het
Spata20 T C 11: 94,374,966 (GRCm39) N212S possibly damaging Het
Sphkap A C 1: 83,256,683 (GRCm39) C355W probably damaging Het
Spopfm2 T C 3: 94,082,848 (GRCm39) K321R probably benign Het
Spsb1 T A 4: 149,991,566 (GRCm39) M1L probably damaging Het
Srebf2 C T 15: 82,062,966 (GRCm39) R468C probably damaging Het
Stxbp5 A C 10: 9,646,439 (GRCm39) probably null Het
Taar5 G C 10: 23,847,120 (GRCm39) D173H possibly damaging Het
Tfrc A G 16: 32,440,101 (GRCm39) D438G probably null Het
Tinag A T 9: 76,907,131 (GRCm39) I368K probably benign Het
Tm9sf1 A G 14: 55,873,906 (GRCm39) W531R probably damaging Het
Tnc G T 4: 63,918,961 (GRCm39) P1154Q possibly damaging Het
Toporsl A G 4: 52,611,645 (GRCm39) R513G probably damaging Het
Vat1 A G 11: 101,356,956 (GRCm39) S2P probably benign Het
Vmn2r107 C G 17: 20,577,270 (GRCm39) P423A probably benign Het
Vmn2r2 T A 3: 64,024,808 (GRCm39) E591V probably damaging Het
Vmn2r62 T A 7: 42,437,281 (GRCm39) Y401F probably damaging Het
Vmn2r62 G A 7: 42,414,031 (GRCm39) T804I probably damaging Het
Vmn2r89 A T 14: 51,693,459 (GRCm39) I270F probably damaging Het
Zfp418 T C 7: 7,185,167 (GRCm39) F377L possibly damaging Het
Zkscan5 T C 5: 145,144,502 (GRCm39) S182P unknown Het
Other mutations in Fez1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02540:Fez1 APN 9 36,761,695 (GRCm39) missense probably damaging 0.97
R1280:Fez1 UTSW 9 36,781,845 (GRCm39) frame shift probably null
R1458:Fez1 UTSW 9 36,781,845 (GRCm39) frame shift probably null
R1741:Fez1 UTSW 9 36,755,029 (GRCm39) missense probably damaging 1.00
R1846:Fez1 UTSW 9 36,779,063 (GRCm39) missense probably damaging 1.00
R2072:Fez1 UTSW 9 36,779,241 (GRCm39) missense probably benign 0.00
R4193:Fez1 UTSW 9 36,755,023 (GRCm39) missense probably damaging 1.00
R4214:Fez1 UTSW 9 36,781,784 (GRCm39) missense probably damaging 0.99
R4417:Fez1 UTSW 9 36,781,768 (GRCm39) splice site probably benign
R4696:Fez1 UTSW 9 36,781,766 (GRCm39) splice site probably null
R4735:Fez1 UTSW 9 36,772,141 (GRCm39) nonsense probably null
R4947:Fez1 UTSW 9 36,780,171 (GRCm39) missense probably damaging 0.99
R4950:Fez1 UTSW 9 36,779,178 (GRCm39) missense probably damaging 1.00
R5538:Fez1 UTSW 9 36,780,172 (GRCm39) missense probably damaging 1.00
R5618:Fez1 UTSW 9 36,755,228 (GRCm39) missense probably damaging 1.00
R5742:Fez1 UTSW 9 36,761,743 (GRCm39) critical splice donor site probably null
R7089:Fez1 UTSW 9 36,778,999 (GRCm39) missense probably benign 0.00
R7250:Fez1 UTSW 9 36,779,090 (GRCm39) missense probably damaging 1.00
R7387:Fez1 UTSW 9 36,779,108 (GRCm39) missense probably damaging 1.00
R7653:Fez1 UTSW 9 36,772,146 (GRCm39) missense probably benign 0.38
R7662:Fez1 UTSW 9 36,781,796 (GRCm39) missense probably damaging 1.00
R8341:Fez1 UTSW 9 36,787,605 (GRCm39) missense possibly damaging 0.94
R9414:Fez1 UTSW 9 36,779,247 (GRCm39) missense probably benign
R9484:Fez1 UTSW 9 36,755,093 (GRCm39) missense probably benign
R9549:Fez1 UTSW 9 36,780,211 (GRCm39) missense possibly damaging 0.91
Z1177:Fez1 UTSW 9 36,779,055 (GRCm39) missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- CCACTGGTGAGTCTGGATGAAG -3'
(R):5'- TAGTCCAGTCCACGTAAACTCG -3'

Sequencing Primer
(F):5'- TTGAAGATATCAGGCCCAGTTGC -3'
(R):5'- AGTCCACGTAAACTCGTAGGCG -3'
Posted On 2020-09-15