Incidental Mutation 'R7974:Tinag'
ID 650784
Institutional Source Beutler Lab
Gene Symbol Tinag
Ensembl Gene ENSMUSG00000032357
Gene Name tubulointerstitial nephritis antigen
Synonyms TIN-ag
MMRRC Submission 046017-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.094) question?
Stock # R7974 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 76858975-76953076 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 76907131 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Lysine at position 368 (I368K)
Ref Sequence ENSEMBL: ENSMUSP00000034911 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034911] [ENSMUST00000184897]
AlphaFold Q9WUR0
Predicted Effect probably benign
Transcript: ENSMUST00000034911
AA Change: I368K

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000034911
Gene: ENSMUSG00000032357
AA Change: I368K

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
SO 58 105 1.68e-11 SMART
Pept_C1 216 466 1.83e-52 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000184897
SMART Domains Protein: ENSMUSP00000139155
Gene: ENSMUSG00000032357

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
SO 58 105 1.68e-11 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (64/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a glycoprotein that is restricted within the kidney to the basement membranes underlying the epithelium of Bowman's capsule and proximal and distal tubules. Autoantibodies against this protein are found in sera of patients with tubulointerstital nephritis, membranous nephropathy and anti-glomerular basement membrane nephritis. Ontogeny studies suggest that the expression of this antigen is developmentally regulated in a precise spatial and temporal pattern throughout nephrogenesis. [provided by RefSeq, Nov 2011]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim1 C T 19: 57,033,405 (GRCm39) probably null Het
Adamts19 A T 18: 59,144,094 (GRCm39) Q892L possibly damaging Het
Adamts9 A G 6: 92,886,668 (GRCm39) probably null Het
Aftph T C 11: 20,648,233 (GRCm39) *686W probably null Het
AI661453 T C 17: 47,777,006 (GRCm39) L244P unknown Het
Ankar C A 1: 72,738,138 (GRCm39) E15* probably null Het
Ankrd39 A G 1: 36,585,999 (GRCm39) probably benign Het
Arsi A G 18: 61,045,478 (GRCm39) D56G probably damaging Het
Blmh T C 11: 76,856,729 (GRCm39) I245T possibly damaging Het
Ccr6 T C 17: 8,475,056 (GRCm39) F87S probably damaging Het
Cdc42ep2 T C 19: 5,968,523 (GRCm39) K61E probably damaging Het
Celsr1 C T 15: 85,915,231 (GRCm39) G914D probably damaging Het
Cep126 T A 9: 8,120,764 (GRCm39) K86N probably benign Het
Cfap70 A T 14: 20,470,818 (GRCm39) F532I probably damaging Het
Cpsf3 T A 12: 21,358,006 (GRCm39) L506Q probably damaging Het
Dct A C 14: 118,277,067 (GRCm39) I273S probably damaging Het
Dsel T C 1: 111,788,229 (GRCm39) I769V probably benign Het
Dus2 G A 8: 106,762,652 (GRCm39) E138K probably benign Het
Emsy A G 7: 98,279,425 (GRCm39) S305P possibly damaging Het
Erp27 A T 6: 136,885,063 (GRCm39) V245D probably damaging Het
Fez1 C A 9: 36,755,244 (GRCm39) T81K probably damaging Het
Gli3 A C 13: 15,900,841 (GRCm39) Q1409H probably benign Het
Hdac9 T C 12: 34,353,219 (GRCm39) S664G possibly damaging Het
Hibadh A G 6: 52,534,880 (GRCm39) S167P probably benign Het
Hsdl1 A G 8: 120,293,072 (GRCm39) V121A probably benign Het
Ift70a1 T C 2: 75,810,688 (GRCm39) H465R probably damaging Het
Ighv1-18 A C 12: 114,646,669 (GRCm39) I6S possibly damaging Het
Iqcm T A 8: 76,281,520 (GRCm39) M1K probably null Het
Itch T C 2: 155,034,079 (GRCm39) F417S probably damaging Het
Itpr1 C T 6: 108,500,366 (GRCm39) T2653I possibly damaging Het
Kank1 T G 19: 25,401,584 (GRCm39) Y1064D probably damaging Het
Kmt2c T C 5: 25,505,561 (GRCm39) Q3249R probably damaging Het
Lefty1 T C 1: 180,765,385 (GRCm39) C318R probably damaging Het
Lmbr1l C T 15: 98,809,500 (GRCm39) V147I probably benign Het
Meig1 C A 2: 3,412,911 (GRCm39) E37* probably null Het
Mpp3 A G 11: 101,899,180 (GRCm39) probably null Het
Muc17 T C 5: 137,175,664 (GRCm39) N2S Het
Mup7 T C 4: 60,067,518 (GRCm39) E199G possibly damaging Het
Nol4 G C 18: 22,852,082 (GRCm39) Y275* probably null Het
Nrxn1 G A 17: 91,008,207 (GRCm39) P429S probably damaging Het
Or14j8 T C 17: 38,263,672 (GRCm39) Y81C probably damaging Het
Pfkl A T 10: 77,829,996 (GRCm39) F367L probably damaging Het
Pik3cg T C 12: 32,254,031 (GRCm39) E652G probably benign Het
Prkag3 A G 1: 74,783,980 (GRCm39) I301T probably benign Het
Rcn1 G A 2: 105,224,055 (GRCm39) P163L probably benign Het
Slc1a7 G A 4: 107,869,473 (GRCm39) V513M probably benign Het
Slc37a2 A T 9: 37,150,421 (GRCm39) probably null Het
Slc9b1 C T 3: 135,099,791 (GRCm39) T437I possibly damaging Het
Smap1 T G 1: 23,888,522 (GRCm39) T248P probably benign Het
Smpd3 A C 8: 106,982,254 (GRCm39) C617G probably benign Het
Spata20 T C 11: 94,374,966 (GRCm39) N212S possibly damaging Het
Sphkap A C 1: 83,256,683 (GRCm39) C355W probably damaging Het
Spopfm2 T C 3: 94,082,848 (GRCm39) K321R probably benign Het
Spsb1 T A 4: 149,991,566 (GRCm39) M1L probably damaging Het
Srebf2 C T 15: 82,062,966 (GRCm39) R468C probably damaging Het
Stxbp5 A C 10: 9,646,439 (GRCm39) probably null Het
Taar5 G C 10: 23,847,120 (GRCm39) D173H possibly damaging Het
Tfrc A G 16: 32,440,101 (GRCm39) D438G probably null Het
Tm9sf1 A G 14: 55,873,906 (GRCm39) W531R probably damaging Het
Tnc G T 4: 63,918,961 (GRCm39) P1154Q possibly damaging Het
Toporsl A G 4: 52,611,645 (GRCm39) R513G probably damaging Het
Vat1 A G 11: 101,356,956 (GRCm39) S2P probably benign Het
Vmn2r107 C G 17: 20,577,270 (GRCm39) P423A probably benign Het
Vmn2r2 T A 3: 64,024,808 (GRCm39) E591V probably damaging Het
Vmn2r62 T A 7: 42,437,281 (GRCm39) Y401F probably damaging Het
Vmn2r62 G A 7: 42,414,031 (GRCm39) T804I probably damaging Het
Vmn2r89 A T 14: 51,693,459 (GRCm39) I270F probably damaging Het
Zfp418 T C 7: 7,185,167 (GRCm39) F377L possibly damaging Het
Zkscan5 T C 5: 145,144,502 (GRCm39) S182P unknown Het
Other mutations in Tinag
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01450:Tinag APN 9 76,952,858 (GRCm39) missense possibly damaging 0.93
IGL01524:Tinag APN 9 76,952,820 (GRCm39) missense probably damaging 1.00
IGL01537:Tinag APN 9 76,952,885 (GRCm39) missense probably benign 0.01
IGL01832:Tinag APN 9 76,939,038 (GRCm39) missense probably benign 0.18
IGL02512:Tinag APN 9 76,939,069 (GRCm39) splice site probably benign
IGL02888:Tinag APN 9 76,938,995 (GRCm39) missense probably benign 0.24
G1citation:Tinag UTSW 9 76,938,984 (GRCm39) missense probably benign 0.00
R0179:Tinag UTSW 9 76,904,164 (GRCm39) splice site probably benign
R0200:Tinag UTSW 9 76,859,217 (GRCm39) missense probably damaging 1.00
R0206:Tinag UTSW 9 76,907,134 (GRCm39) missense probably damaging 1.00
R0545:Tinag UTSW 9 76,938,992 (GRCm39) missense possibly damaging 0.61
R0666:Tinag UTSW 9 76,912,969 (GRCm39) missense probably benign 0.02
R0685:Tinag UTSW 9 76,859,285 (GRCm39) missense probably damaging 1.00
R0732:Tinag UTSW 9 76,908,936 (GRCm39) missense possibly damaging 0.93
R1445:Tinag UTSW 9 76,952,798 (GRCm39) missense probably damaging 1.00
R2318:Tinag UTSW 9 76,952,693 (GRCm39) missense probably damaging 1.00
R3809:Tinag UTSW 9 76,859,187 (GRCm39) missense probably benign 0.15
R4747:Tinag UTSW 9 76,904,238 (GRCm39) missense probably benign
R4781:Tinag UTSW 9 76,904,232 (GRCm39) missense possibly damaging 0.69
R5110:Tinag UTSW 9 76,859,289 (GRCm39) missense probably damaging 1.00
R5328:Tinag UTSW 9 76,912,913 (GRCm39) nonsense probably null
R5605:Tinag UTSW 9 76,952,694 (GRCm39) missense probably damaging 1.00
R5897:Tinag UTSW 9 76,952,726 (GRCm39) missense probably damaging 1.00
R6296:Tinag UTSW 9 76,904,217 (GRCm39) missense possibly damaging 0.67
R6822:Tinag UTSW 9 76,938,984 (GRCm39) missense probably benign 0.00
R6915:Tinag UTSW 9 76,908,897 (GRCm39) missense probably damaging 1.00
R7285:Tinag UTSW 9 76,952,943 (GRCm39) missense probably benign
R7334:Tinag UTSW 9 76,908,931 (GRCm39) missense probably damaging 1.00
R8354:Tinag UTSW 9 76,938,977 (GRCm39) missense probably damaging 1.00
R8454:Tinag UTSW 9 76,938,977 (GRCm39) missense probably damaging 1.00
R9029:Tinag UTSW 9 76,934,296 (GRCm39) splice site probably benign
R9072:Tinag UTSW 9 76,904,300 (GRCm39) critical splice acceptor site probably null
R9073:Tinag UTSW 9 76,904,300 (GRCm39) critical splice acceptor site probably null
R9508:Tinag UTSW 9 76,912,981 (GRCm39) missense probably damaging 1.00
Z1177:Tinag UTSW 9 76,952,780 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- CTCATGATATGCTTTGATGGGCC -3'
(R):5'- AGCAAGTTCATCAATGCAGTATTGG -3'

Sequencing Primer
(F):5'- CCAGTCTTCTATGAGTGCACAGG -3'
(R):5'- GGTGCATGTGACCATTTCAAAGC -3'
Posted On 2020-09-15