Mutagenetix > Incidental Mutation

Incidental Mutation 'R7974:Tinag'

650784

Institutional Source

Beutler Lab

Gene Symbol

Tinag

Ensembl Gene

ENSMUSG00000032357

Gene Name

tubulointerstitial nephritis antigen

Synonyms

TIN-ag

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.112) question?

Stock #

R7974 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

76951693-77045794 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 76999849 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Lysine at position 368 (I368K)

Ref Sequence

ENSEMBL: ENSMUSP00000034911 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034911] [ENSMUST00000184897]

AlphaFold

Q9WUR0

Predicted Effect

probably benign
Transcript: ENSMUST00000034911
AA Change: I368K

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)

SMART Domains

Protein: ENSMUSP00000034911
Gene: ENSMUSG00000032357
AA Change: I368K

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
SO	58	105	1.68e-11	SMART
Pept_C1	216	466	1.83e-52	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000184897

SMART Domains

Protein: ENSMUSP00000139155
Gene: ENSMUSG00000032357

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
SO	58	105	1.68e-11	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

100% (64/64)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a glycoprotein that is restricted within the kidney to the basement membranes underlying the epithelium of Bowman's capsule and proximal and distal tubules. Autoantibodies against this protein are found in sera of patients with tubulointerstital nephritis, membranous nephropathy and anti-glomerular basement membrane nephritis. Ontogeny studies suggest that the expression of this antigen is developmentally regulated in a precise spatial and temporal pattern throughout nephrogenesis. [provided by RefSeq, Nov 2011]

Allele List at MGI

Other mutations in this stock

Total: 69 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ablim1	C	T	19: 57,044,973		probably null	Het
Adamts19	A	T	18: 59,011,022	Q892L	possibly damaging	Het
Adamts9	A	G	6: 92,909,687		probably null	Het
Aftph	T	C	11: 20,698,233	*686W	probably null	Het
AI661453	T	C	17: 47,466,081	L244P	unknown	Het
Ankar	C	A	1: 72,698,979	E15*	probably null	Het
Ankrd39	A	G	1: 36,546,918		probably benign	Het
Arsi	A	G	18: 60,912,406	D56G	probably damaging	Het
Blmh	T	C	11: 76,965,903	I245T	possibly damaging	Het
Ccr6	T	C	17: 8,256,224	F87S	probably damaging	Het
Cdc42ep2	T	C	19: 5,918,495	K61E	probably damaging	Het
Celsr1	C	T	15: 86,031,030	G914D	probably damaging	Het
Cep126	T	A	9: 8,120,763	K86N	probably benign	Het
Cfap70	A	T	14: 20,420,750	F532I	probably damaging	Het
Cpsf3	T	A	12: 21,308,005	L506Q	probably damaging	Het
Dct	A	C	14: 118,039,655	I273S	probably damaging	Het
Dsel	T	C	1: 111,860,499	I769V	probably benign	Het
Dus2	G	A	8: 106,036,020	E138K	probably benign	Het
Emsy	A	G	7: 98,630,218	S305P	possibly damaging	Het
Erp27	A	T	6: 136,908,065	V245D	probably damaging	Het
Fez1	C	A	9: 36,843,948	T81K	probably damaging	Het
Gli3	A	C	13: 15,726,256	Q1409H	probably benign	Het
Gm10696	T	C	3: 94,175,541	K321R	probably benign	Het
Hdac9	T	C	12: 34,303,220	S664G	possibly damaging	Het
Hibadh	A	G	6: 52,557,895	S167P	probably benign	Het
Hsdl1	A	G	8: 119,566,333	V121A	probably benign	Het
Ighv1-18	A	C	12: 114,683,049	I6S	possibly damaging	Het
Iqcm	T	A	8: 75,554,892	M1K	probably null	Het
Itch	T	C	2: 155,192,159	F417S	probably damaging	Het
Itpr1	C	T	6: 108,523,405	T2653I	possibly damaging	Het
Kank1	T	G	19: 25,424,220	Y1064D	probably damaging	Het
Kmt2c	T	C	5: 25,300,563	Q3249R	probably damaging	Het
Lefty1	T	C	1: 180,937,820	C318R	probably damaging	Het
Lmbr1l	C	T	15: 98,911,619	V147I	probably benign	Het
Meig1	C	A	2: 3,411,874	E37*	probably null	Het
Mpp3	A	G	11: 102,008,354		probably null	Het
Muc3	T	C	5: 137,146,816	N2S		Het
Mup7	T	C	4: 60,067,518	E199G	possibly damaging	Het
Nol4	G	C	18: 22,719,025	Y275*	probably null	Het
Nrxn1	G	A	17: 90,700,779	P429S	probably damaging	Het
Olfr761	T	C	17: 37,952,781	Y81C	probably damaging	Het
Pfkl	A	T	10: 77,994,162	F367L	probably damaging	Het
Pik3cg	T	C	12: 32,204,032	E652G	probably benign	Het
Prkag3	A	G	1: 74,744,821	I301T	probably benign	Het
Rcn1	G	A	2: 105,393,710	P163L	probably benign	Het
Slc1a7	G	A	4: 108,012,276	V513M	probably benign	Het
Slc37a2	A	T	9: 37,239,125		probably null	Het
Slc9b1	C	T	3: 135,394,030	T437I	possibly damaging	Het
Smap1	T	G	1: 23,849,441	T248P	probably benign	Het
Smpd3	A	C	8: 106,255,622	C617G	probably benign	Het
Spata20	T	C	11: 94,484,140	N212S	possibly damaging	Het
Sphkap	A	C	1: 83,278,962	C355W	probably damaging	Het
Spsb1	T	A	4: 149,907,109	M1L	probably damaging	Het
Srebf2	C	T	15: 82,178,765	R468C	probably damaging	Het
Stxbp5	A	C	10: 9,770,695		probably null	Het
Taar5	G	C	10: 23,971,222	D173H	possibly damaging	Het
Tfrc	A	G	16: 32,621,283	D438G	probably null	Het
Tm9sf1	A	G	14: 55,636,449	W531R	probably damaging	Het
Tnc	G	T	4: 64,000,724	P1154Q	possibly damaging	Het
Toporsl	A	G	4: 52,611,645	R513G	probably damaging	Het
Ttc30a1	T	C	2: 75,980,344	H465R	probably damaging	Het
Vat1	A	G	11: 101,466,130	S2P	probably benign	Het
Vmn2r107	C	G	17: 20,357,008	P423A	probably benign	Het
Vmn2r2	T	A	3: 64,117,387	E591V	probably damaging	Het
Vmn2r62	G	A	7: 42,764,607	T804I	probably damaging	Het
Vmn2r62	T	A	7: 42,787,857	Y401F	probably damaging	Het
Vmn2r89	A	T	14: 51,456,002	I270F	probably damaging	Het
Zfp418	T	C	7: 7,182,168	F377L	possibly damaging	Het
Zkscan5	T	C	5: 145,207,692	S182P	unknown	Het

Other mutations in Tinag

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01450:Tinag	APN	9	77045576	missense	possibly damaging	0.93
IGL01524:Tinag	APN	9	77045538	missense	probably damaging	1.00
IGL01537:Tinag	APN	9	77045603	missense	probably benign	0.01
IGL01832:Tinag	APN	9	77031756	missense	probably benign	0.18
IGL02512:Tinag	APN	9	77031787	splice site	probably benign
IGL02888:Tinag	APN	9	77031713	missense	probably benign	0.24
G1citation:Tinag	UTSW	9	77031702	missense	probably benign	0.00
R0179:Tinag	UTSW	9	76996882	splice site	probably benign
R0200:Tinag	UTSW	9	76951935	missense	probably damaging	1.00
R0206:Tinag	UTSW	9	76999852	missense	probably damaging	1.00
R0545:Tinag	UTSW	9	77031710	missense	possibly damaging	0.61
R0666:Tinag	UTSW	9	77005687	missense	probably benign	0.02
R0685:Tinag	UTSW	9	76952003	missense	probably damaging	1.00
R0732:Tinag	UTSW	9	77001654	missense	possibly damaging	0.93
R1445:Tinag	UTSW	9	77045516	missense	probably damaging	1.00
R2318:Tinag	UTSW	9	77045411	missense	probably damaging	1.00
R3809:Tinag	UTSW	9	76951905	missense	probably benign	0.15
R4747:Tinag	UTSW	9	76996956	missense	probably benign
R4781:Tinag	UTSW	9	76996950	missense	possibly damaging	0.69
R5110:Tinag	UTSW	9	76952007	missense	probably damaging	1.00
R5328:Tinag	UTSW	9	77005631	nonsense	probably null
R5605:Tinag	UTSW	9	77045412	missense	probably damaging	1.00
R5897:Tinag	UTSW	9	77045444	missense	probably damaging	1.00
R6296:Tinag	UTSW	9	76996935	missense	possibly damaging	0.67
R6822:Tinag	UTSW	9	77031702	missense	probably benign	0.00
R6915:Tinag	UTSW	9	77001615	missense	probably damaging	1.00
R7285:Tinag	UTSW	9	77045661	missense	probably benign
R7334:Tinag	UTSW	9	77001649	missense	probably damaging	1.00
R8354:Tinag	UTSW	9	77031695	missense	probably damaging	1.00
R8454:Tinag	UTSW	9	77031695	missense	probably damaging	1.00
R9029:Tinag	UTSW	9	77027014	splice site	probably benign
R9072:Tinag	UTSW	9	76997018	critical splice acceptor site	probably null
R9073:Tinag	UTSW	9	76997018	critical splice acceptor site	probably null
R9508:Tinag	UTSW	9	77005699	missense	probably damaging	1.00
Z1177:Tinag	UTSW	9	77045498	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- CTCATGATATGCTTTGATGGGCC -3'
(R):5'- AGCAAGTTCATCAATGCAGTATTGG -3'

Sequencing Primer
(F):5'- CCAGTCTTCTATGAGTGCACAGG -3'
(R):5'- GGTGCATGTGACCATTTCAAAGC -3'

Posted On

2020-09-15