Incidental Mutation 'R7974:Tinag'
ID 650784
Institutional Source Beutler Lab
Gene Symbol Tinag
Ensembl Gene ENSMUSG00000032357
Gene Name tubulointerstitial nephritis antigen
Synonyms TIN-ag
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.112) question?
Stock # R7974 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 76951693-77045794 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 76999849 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Lysine at position 368 (I368K)
Ref Sequence ENSEMBL: ENSMUSP00000034911 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034911] [ENSMUST00000184897]
AlphaFold Q9WUR0
Predicted Effect probably benign
Transcript: ENSMUST00000034911
AA Change: I368K

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000034911
Gene: ENSMUSG00000032357
AA Change: I368K

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
SO 58 105 1.68e-11 SMART
Pept_C1 216 466 1.83e-52 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000184897
SMART Domains Protein: ENSMUSP00000139155
Gene: ENSMUSG00000032357

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
SO 58 105 1.68e-11 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (64/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a glycoprotein that is restricted within the kidney to the basement membranes underlying the epithelium of Bowman's capsule and proximal and distal tubules. Autoantibodies against this protein are found in sera of patients with tubulointerstital nephritis, membranous nephropathy and anti-glomerular basement membrane nephritis. Ontogeny studies suggest that the expression of this antigen is developmentally regulated in a precise spatial and temporal pattern throughout nephrogenesis. [provided by RefSeq, Nov 2011]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim1 C T 19: 57,044,973 probably null Het
Adamts19 A T 18: 59,011,022 Q892L possibly damaging Het
Adamts9 A G 6: 92,909,687 probably null Het
Aftph T C 11: 20,698,233 *686W probably null Het
AI661453 T C 17: 47,466,081 L244P unknown Het
Ankar C A 1: 72,698,979 E15* probably null Het
Ankrd39 A G 1: 36,546,918 probably benign Het
Arsi A G 18: 60,912,406 D56G probably damaging Het
Blmh T C 11: 76,965,903 I245T possibly damaging Het
Ccr6 T C 17: 8,256,224 F87S probably damaging Het
Cdc42ep2 T C 19: 5,918,495 K61E probably damaging Het
Celsr1 C T 15: 86,031,030 G914D probably damaging Het
Cep126 T A 9: 8,120,763 K86N probably benign Het
Cfap70 A T 14: 20,420,750 F532I probably damaging Het
Cpsf3 T A 12: 21,308,005 L506Q probably damaging Het
Dct A C 14: 118,039,655 I273S probably damaging Het
Dsel T C 1: 111,860,499 I769V probably benign Het
Dus2 G A 8: 106,036,020 E138K probably benign Het
Emsy A G 7: 98,630,218 S305P possibly damaging Het
Erp27 A T 6: 136,908,065 V245D probably damaging Het
Fez1 C A 9: 36,843,948 T81K probably damaging Het
Gli3 A C 13: 15,726,256 Q1409H probably benign Het
Gm10696 T C 3: 94,175,541 K321R probably benign Het
Hdac9 T C 12: 34,303,220 S664G possibly damaging Het
Hibadh A G 6: 52,557,895 S167P probably benign Het
Hsdl1 A G 8: 119,566,333 V121A probably benign Het
Ighv1-18 A C 12: 114,683,049 I6S possibly damaging Het
Iqcm T A 8: 75,554,892 M1K probably null Het
Itch T C 2: 155,192,159 F417S probably damaging Het
Itpr1 C T 6: 108,523,405 T2653I possibly damaging Het
Kank1 T G 19: 25,424,220 Y1064D probably damaging Het
Kmt2c T C 5: 25,300,563 Q3249R probably damaging Het
Lefty1 T C 1: 180,937,820 C318R probably damaging Het
Lmbr1l C T 15: 98,911,619 V147I probably benign Het
Meig1 C A 2: 3,411,874 E37* probably null Het
Mpp3 A G 11: 102,008,354 probably null Het
Muc3 T C 5: 137,146,816 N2S Het
Mup7 T C 4: 60,067,518 E199G possibly damaging Het
Nol4 G C 18: 22,719,025 Y275* probably null Het
Nrxn1 G A 17: 90,700,779 P429S probably damaging Het
Olfr761 T C 17: 37,952,781 Y81C probably damaging Het
Pfkl A T 10: 77,994,162 F367L probably damaging Het
Pik3cg T C 12: 32,204,032 E652G probably benign Het
Prkag3 A G 1: 74,744,821 I301T probably benign Het
Rcn1 G A 2: 105,393,710 P163L probably benign Het
Slc1a7 G A 4: 108,012,276 V513M probably benign Het
Slc37a2 A T 9: 37,239,125 probably null Het
Slc9b1 C T 3: 135,394,030 T437I possibly damaging Het
Smap1 T G 1: 23,849,441 T248P probably benign Het
Smpd3 A C 8: 106,255,622 C617G probably benign Het
Spata20 T C 11: 94,484,140 N212S possibly damaging Het
Sphkap A C 1: 83,278,962 C355W probably damaging Het
Spsb1 T A 4: 149,907,109 M1L probably damaging Het
Srebf2 C T 15: 82,178,765 R468C probably damaging Het
Stxbp5 A C 10: 9,770,695 probably null Het
Taar5 G C 10: 23,971,222 D173H possibly damaging Het
Tfrc A G 16: 32,621,283 D438G probably null Het
Tm9sf1 A G 14: 55,636,449 W531R probably damaging Het
Tnc G T 4: 64,000,724 P1154Q possibly damaging Het
Toporsl A G 4: 52,611,645 R513G probably damaging Het
Ttc30a1 T C 2: 75,980,344 H465R probably damaging Het
Vat1 A G 11: 101,466,130 S2P probably benign Het
Vmn2r107 C G 17: 20,357,008 P423A probably benign Het
Vmn2r2 T A 3: 64,117,387 E591V probably damaging Het
Vmn2r62 G A 7: 42,764,607 T804I probably damaging Het
Vmn2r62 T A 7: 42,787,857 Y401F probably damaging Het
Vmn2r89 A T 14: 51,456,002 I270F probably damaging Het
Zfp418 T C 7: 7,182,168 F377L possibly damaging Het
Zkscan5 T C 5: 145,207,692 S182P unknown Het
Other mutations in Tinag
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01450:Tinag APN 9 77045576 missense possibly damaging 0.93
IGL01524:Tinag APN 9 77045538 missense probably damaging 1.00
IGL01537:Tinag APN 9 77045603 missense probably benign 0.01
IGL01832:Tinag APN 9 77031756 missense probably benign 0.18
IGL02512:Tinag APN 9 77031787 splice site probably benign
IGL02888:Tinag APN 9 77031713 missense probably benign 0.24
G1citation:Tinag UTSW 9 77031702 missense probably benign 0.00
R0179:Tinag UTSW 9 76996882 splice site probably benign
R0200:Tinag UTSW 9 76951935 missense probably damaging 1.00
R0206:Tinag UTSW 9 76999852 missense probably damaging 1.00
R0545:Tinag UTSW 9 77031710 missense possibly damaging 0.61
R0666:Tinag UTSW 9 77005687 missense probably benign 0.02
R0685:Tinag UTSW 9 76952003 missense probably damaging 1.00
R0732:Tinag UTSW 9 77001654 missense possibly damaging 0.93
R1445:Tinag UTSW 9 77045516 missense probably damaging 1.00
R2318:Tinag UTSW 9 77045411 missense probably damaging 1.00
R3809:Tinag UTSW 9 76951905 missense probably benign 0.15
R4747:Tinag UTSW 9 76996956 missense probably benign
R4781:Tinag UTSW 9 76996950 missense possibly damaging 0.69
R5110:Tinag UTSW 9 76952007 missense probably damaging 1.00
R5328:Tinag UTSW 9 77005631 nonsense probably null
R5605:Tinag UTSW 9 77045412 missense probably damaging 1.00
R5897:Tinag UTSW 9 77045444 missense probably damaging 1.00
R6296:Tinag UTSW 9 76996935 missense possibly damaging 0.67
R6822:Tinag UTSW 9 77031702 missense probably benign 0.00
R6915:Tinag UTSW 9 77001615 missense probably damaging 1.00
R7285:Tinag UTSW 9 77045661 missense probably benign
R7334:Tinag UTSW 9 77001649 missense probably damaging 1.00
R8354:Tinag UTSW 9 77031695 missense probably damaging 1.00
R8454:Tinag UTSW 9 77031695 missense probably damaging 1.00
R9029:Tinag UTSW 9 77027014 splice site probably benign
R9072:Tinag UTSW 9 76997018 critical splice acceptor site probably null
R9073:Tinag UTSW 9 76997018 critical splice acceptor site probably null
R9508:Tinag UTSW 9 77005699 missense probably damaging 1.00
Z1177:Tinag UTSW 9 77045498 missense probably benign
Predicted Primers PCR Primer
(F):5'- CTCATGATATGCTTTGATGGGCC -3'
(R):5'- AGCAAGTTCATCAATGCAGTATTGG -3'

Sequencing Primer
(F):5'- CCAGTCTTCTATGAGTGCACAGG -3'
(R):5'- GGTGCATGTGACCATTTCAAAGC -3'
Posted On 2020-09-15