Incidental Mutation 'R7974:Blmh'
ID 650787
Institutional Source Beutler Lab
Gene Symbol Blmh
Ensembl Gene ENSMUSG00000020840
Gene Name bleomycin hydrolase
Synonyms
MMRRC Submission 046017-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.323) question?
Stock # R7974 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 76836482-76878215 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 76856729 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 245 (I245T)
Ref Sequence ENSEMBL: ENSMUSP00000021197 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021197] [ENSMUST00000125145] [ENSMUST00000168124]
AlphaFold Q8R016
Predicted Effect possibly damaging
Transcript: ENSMUST00000021197
AA Change: I245T

PolyPhen 2 Score 0.924 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000021197
Gene: ENSMUSG00000020840
AA Change: I245T

DomainStartEndE-ValueType
Pfam:Peptidase_C1_2 5 451 1.8e-210 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000125145
AA Change: I108T

PolyPhen 2 Score 0.924 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000132739
Gene: ENSMUSG00000020840
AA Change: I108T

DomainStartEndE-ValueType
Pfam:Peptidase_C1_2 1 179 6.5e-82 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000168124
SMART Domains Protein: ENSMUSP00000130370
Gene: ENSMUSG00000020840

DomainStartEndE-ValueType
Pfam:Peptidase_C1_2 5 70 4.1e-11 PFAM
Meta Mutation Damage Score 0.0891 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (64/64)
MGI Phenotype FUNCTION: The encoded protein is a cytoplasmic cysteine peptidase involved in inactivation of bleomycin, a glycopeptide which is a component of combination chemotherapy regimens for cancer. This encoded enzyme is highly conserved, and it contains the signature active site residues of cysteine protease papain superfamily enzymes. It is postulated that this enzyme has protective effects against bleomycin-induced pulmonary fibrosis and bleomycin tumor resistance. [provided by RefSeq, Jan 2010]
PHENOTYPE: About one-third of homozygous null mutants die neonatally; survivors develop variably penetrant tail dermatitis and pulmonary fibrosis following bleomycin treatment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim1 C T 19: 57,033,405 (GRCm39) probably null Het
Adamts19 A T 18: 59,144,094 (GRCm39) Q892L possibly damaging Het
Adamts9 A G 6: 92,886,668 (GRCm39) probably null Het
Aftph T C 11: 20,648,233 (GRCm39) *686W probably null Het
AI661453 T C 17: 47,777,006 (GRCm39) L244P unknown Het
Ankar C A 1: 72,738,138 (GRCm39) E15* probably null Het
Ankrd39 A G 1: 36,585,999 (GRCm39) probably benign Het
Arsi A G 18: 61,045,478 (GRCm39) D56G probably damaging Het
Ccr6 T C 17: 8,475,056 (GRCm39) F87S probably damaging Het
Cdc42ep2 T C 19: 5,968,523 (GRCm39) K61E probably damaging Het
Celsr1 C T 15: 85,915,231 (GRCm39) G914D probably damaging Het
Cep126 T A 9: 8,120,764 (GRCm39) K86N probably benign Het
Cfap70 A T 14: 20,470,818 (GRCm39) F532I probably damaging Het
Cpsf3 T A 12: 21,358,006 (GRCm39) L506Q probably damaging Het
Dct A C 14: 118,277,067 (GRCm39) I273S probably damaging Het
Dsel T C 1: 111,788,229 (GRCm39) I769V probably benign Het
Dus2 G A 8: 106,762,652 (GRCm39) E138K probably benign Het
Emsy A G 7: 98,279,425 (GRCm39) S305P possibly damaging Het
Erp27 A T 6: 136,885,063 (GRCm39) V245D probably damaging Het
Fez1 C A 9: 36,755,244 (GRCm39) T81K probably damaging Het
Gli3 A C 13: 15,900,841 (GRCm39) Q1409H probably benign Het
Hdac9 T C 12: 34,353,219 (GRCm39) S664G possibly damaging Het
Hibadh A G 6: 52,534,880 (GRCm39) S167P probably benign Het
Hsdl1 A G 8: 120,293,072 (GRCm39) V121A probably benign Het
Ift70a1 T C 2: 75,810,688 (GRCm39) H465R probably damaging Het
Ighv1-18 A C 12: 114,646,669 (GRCm39) I6S possibly damaging Het
Iqcm T A 8: 76,281,520 (GRCm39) M1K probably null Het
Itch T C 2: 155,034,079 (GRCm39) F417S probably damaging Het
Itpr1 C T 6: 108,500,366 (GRCm39) T2653I possibly damaging Het
Kank1 T G 19: 25,401,584 (GRCm39) Y1064D probably damaging Het
Kmt2c T C 5: 25,505,561 (GRCm39) Q3249R probably damaging Het
Lefty1 T C 1: 180,765,385 (GRCm39) C318R probably damaging Het
Lmbr1l C T 15: 98,809,500 (GRCm39) V147I probably benign Het
Meig1 C A 2: 3,412,911 (GRCm39) E37* probably null Het
Mpp3 A G 11: 101,899,180 (GRCm39) probably null Het
Muc17 T C 5: 137,175,664 (GRCm39) N2S Het
Mup7 T C 4: 60,067,518 (GRCm39) E199G possibly damaging Het
Nol4 G C 18: 22,852,082 (GRCm39) Y275* probably null Het
Nrxn1 G A 17: 91,008,207 (GRCm39) P429S probably damaging Het
Or14j8 T C 17: 38,263,672 (GRCm39) Y81C probably damaging Het
Pfkl A T 10: 77,829,996 (GRCm39) F367L probably damaging Het
Pik3cg T C 12: 32,254,031 (GRCm39) E652G probably benign Het
Prkag3 A G 1: 74,783,980 (GRCm39) I301T probably benign Het
Rcn1 G A 2: 105,224,055 (GRCm39) P163L probably benign Het
Slc1a7 G A 4: 107,869,473 (GRCm39) V513M probably benign Het
Slc37a2 A T 9: 37,150,421 (GRCm39) probably null Het
Slc9b1 C T 3: 135,099,791 (GRCm39) T437I possibly damaging Het
Smap1 T G 1: 23,888,522 (GRCm39) T248P probably benign Het
Smpd3 A C 8: 106,982,254 (GRCm39) C617G probably benign Het
Spata20 T C 11: 94,374,966 (GRCm39) N212S possibly damaging Het
Sphkap A C 1: 83,256,683 (GRCm39) C355W probably damaging Het
Spopfm2 T C 3: 94,082,848 (GRCm39) K321R probably benign Het
Spsb1 T A 4: 149,991,566 (GRCm39) M1L probably damaging Het
Srebf2 C T 15: 82,062,966 (GRCm39) R468C probably damaging Het
Stxbp5 A C 10: 9,646,439 (GRCm39) probably null Het
Taar5 G C 10: 23,847,120 (GRCm39) D173H possibly damaging Het
Tfrc A G 16: 32,440,101 (GRCm39) D438G probably null Het
Tinag A T 9: 76,907,131 (GRCm39) I368K probably benign Het
Tm9sf1 A G 14: 55,873,906 (GRCm39) W531R probably damaging Het
Tnc G T 4: 63,918,961 (GRCm39) P1154Q possibly damaging Het
Toporsl A G 4: 52,611,645 (GRCm39) R513G probably damaging Het
Vat1 A G 11: 101,356,956 (GRCm39) S2P probably benign Het
Vmn2r107 C G 17: 20,577,270 (GRCm39) P423A probably benign Het
Vmn2r2 T A 3: 64,024,808 (GRCm39) E591V probably damaging Het
Vmn2r62 T A 7: 42,437,281 (GRCm39) Y401F probably damaging Het
Vmn2r62 G A 7: 42,414,031 (GRCm39) T804I probably damaging Het
Vmn2r89 A T 14: 51,693,459 (GRCm39) I270F probably damaging Het
Zfp418 T C 7: 7,185,167 (GRCm39) F377L possibly damaging Het
Zkscan5 T C 5: 145,144,502 (GRCm39) S182P unknown Het
Other mutations in Blmh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00514:Blmh APN 11 76,857,839 (GRCm39) missense probably damaging 1.00
IGL00661:Blmh APN 11 76,856,758 (GRCm39) nonsense probably null
IGL02701:Blmh APN 11 76,862,736 (GRCm39) missense probably benign 0.00
IGL03350:Blmh APN 11 76,862,774 (GRCm39) missense probably damaging 1.00
R0570:Blmh UTSW 11 76,856,651 (GRCm39) missense probably damaging 1.00
R1519:Blmh UTSW 11 76,857,607 (GRCm39) missense probably damaging 1.00
R6724:Blmh UTSW 11 76,862,733 (GRCm39) critical splice acceptor site probably null
R7054:Blmh UTSW 11 76,859,451 (GRCm39) missense probably damaging 1.00
R7163:Blmh UTSW 11 76,836,987 (GRCm39) missense unknown
R7215:Blmh UTSW 11 76,856,725 (GRCm39) nonsense probably null
R7661:Blmh UTSW 11 76,877,341 (GRCm39) missense probably damaging 1.00
R7807:Blmh UTSW 11 76,837,040 (GRCm39) missense probably benign 0.03
R7843:Blmh UTSW 11 76,837,139 (GRCm39) missense probably damaging 1.00
R7895:Blmh UTSW 11 76,836,721 (GRCm39) critical splice donor site probably null
R8150:Blmh UTSW 11 76,859,455 (GRCm39) missense probably benign 0.32
R8937:Blmh UTSW 11 76,857,883 (GRCm39) missense probably benign
R9756:Blmh UTSW 11 76,859,509 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAGATGTTGAATGTGACAACTCC -3'
(R):5'- ATGCAAACTTCAGGAACCATGC -3'

Sequencing Primer
(F):5'- GTGACAACTCCCATATCTTGGTACAG -3'
(R):5'- GGAACCATGCACATTAACCTGGG -3'
Posted On 2020-09-15