Incidental Mutation 'R7974:Spata20'
ID 650788
Institutional Source Beutler Lab
Gene Symbol Spata20
Ensembl Gene ENSMUSG00000020867
Gene Name spermatogenesis associated 20
Synonyms Tisp78
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.245) question?
Stock # R7974 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 94478904-94486179 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 94484140 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 212 (N212S)
Ref Sequence ENSEMBL: ENSMUSP00000042572 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041705]
AlphaFold Q80YT5
Predicted Effect possibly damaging
Transcript: ENSMUST00000041705
AA Change: N212S

PolyPhen 2 Score 0.658 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000042572
Gene: ENSMUSG00000020867
AA Change: N212S

DomainStartEndE-ValueType
Pfam:Thioredox_DsbH 66 228 2.9e-75 PFAM
Pfam:Thioredoxin_7 86 176 1.5e-13 PFAM
SCOP:d1fp3a_ 464 686 8e-48 SMART
Meta Mutation Damage Score 0.0915 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (64/64)
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim1 C T 19: 57,044,973 probably null Het
Adamts19 A T 18: 59,011,022 Q892L possibly damaging Het
Adamts9 A G 6: 92,909,687 probably null Het
Aftph T C 11: 20,698,233 *686W probably null Het
AI661453 T C 17: 47,466,081 L244P unknown Het
Ankar C A 1: 72,698,979 E15* probably null Het
Ankrd39 A G 1: 36,546,918 probably benign Het
Arsi A G 18: 60,912,406 D56G probably damaging Het
Blmh T C 11: 76,965,903 I245T possibly damaging Het
Ccr6 T C 17: 8,256,224 F87S probably damaging Het
Cdc42ep2 T C 19: 5,918,495 K61E probably damaging Het
Celsr1 C T 15: 86,031,030 G914D probably damaging Het
Cep126 T A 9: 8,120,763 K86N probably benign Het
Cfap70 A T 14: 20,420,750 F532I probably damaging Het
Cpsf3 T A 12: 21,308,005 L506Q probably damaging Het
Dct A C 14: 118,039,655 I273S probably damaging Het
Dsel T C 1: 111,860,499 I769V probably benign Het
Dus2 G A 8: 106,036,020 E138K probably benign Het
Emsy A G 7: 98,630,218 S305P possibly damaging Het
Erp27 A T 6: 136,908,065 V245D probably damaging Het
Fez1 C A 9: 36,843,948 T81K probably damaging Het
Gli3 A C 13: 15,726,256 Q1409H probably benign Het
Gm10696 T C 3: 94,175,541 K321R probably benign Het
Hdac9 T C 12: 34,303,220 S664G possibly damaging Het
Hibadh A G 6: 52,557,895 S167P probably benign Het
Hsdl1 A G 8: 119,566,333 V121A probably benign Het
Ighv1-18 A C 12: 114,683,049 I6S possibly damaging Het
Iqcm T A 8: 75,554,892 M1K probably null Het
Itch T C 2: 155,192,159 F417S probably damaging Het
Itpr1 C T 6: 108,523,405 T2653I possibly damaging Het
Kank1 T G 19: 25,424,220 Y1064D probably damaging Het
Kmt2c T C 5: 25,300,563 Q3249R probably damaging Het
Lefty1 T C 1: 180,937,820 C318R probably damaging Het
Lmbr1l C T 15: 98,911,619 V147I probably benign Het
Meig1 C A 2: 3,411,874 E37* probably null Het
Mpp3 A G 11: 102,008,354 probably null Het
Muc3 T C 5: 137,146,816 N2S Het
Mup7 T C 4: 60,067,518 E199G possibly damaging Het
Nol4 G C 18: 22,719,025 Y275* probably null Het
Nrxn1 G A 17: 90,700,779 P429S probably damaging Het
Olfr761 T C 17: 37,952,781 Y81C probably damaging Het
Pfkl A T 10: 77,994,162 F367L probably damaging Het
Pik3cg T C 12: 32,204,032 E652G probably benign Het
Prkag3 A G 1: 74,744,821 I301T probably benign Het
Rcn1 G A 2: 105,393,710 P163L probably benign Het
Slc1a7 G A 4: 108,012,276 V513M probably benign Het
Slc37a2 A T 9: 37,239,125 probably null Het
Slc9b1 C T 3: 135,394,030 T437I possibly damaging Het
Smap1 T G 1: 23,849,441 T248P probably benign Het
Smpd3 A C 8: 106,255,622 C617G probably benign Het
Sphkap A C 1: 83,278,962 C355W probably damaging Het
Spsb1 T A 4: 149,907,109 M1L probably damaging Het
Srebf2 C T 15: 82,178,765 R468C probably damaging Het
Stxbp5 A C 10: 9,770,695 probably null Het
Taar5 G C 10: 23,971,222 D173H possibly damaging Het
Tfrc A G 16: 32,621,283 D438G probably null Het
Tinag A T 9: 76,999,849 I368K probably benign Het
Tm9sf1 A G 14: 55,636,449 W531R probably damaging Het
Tnc G T 4: 64,000,724 P1154Q possibly damaging Het
Toporsl A G 4: 52,611,645 R513G probably damaging Het
Ttc30a1 T C 2: 75,980,344 H465R probably damaging Het
Vat1 A G 11: 101,466,130 S2P probably benign Het
Vmn2r107 C G 17: 20,357,008 P423A probably benign Het
Vmn2r2 T A 3: 64,117,387 E591V probably damaging Het
Vmn2r62 G A 7: 42,764,607 T804I probably damaging Het
Vmn2r62 T A 7: 42,787,857 Y401F probably damaging Het
Vmn2r89 A T 14: 51,456,002 I270F probably damaging Het
Zfp418 T C 7: 7,182,168 F377L possibly damaging Het
Zkscan5 T C 5: 145,207,692 S182P unknown Het
Other mutations in Spata20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00585:Spata20 APN 11 94479117 missense probably damaging 1.00
IGL01123:Spata20 APN 11 94483395 missense probably benign
IGL02008:Spata20 APN 11 94483463 missense probably damaging 1.00
PIT4458001:Spata20 UTSW 11 94484608 missense probably damaging 1.00
R0136:Spata20 UTSW 11 94480609 missense probably damaging 1.00
R0243:Spata20 UTSW 11 94481646 missense probably benign
R0557:Spata20 UTSW 11 94485222 missense probably benign 0.00
R0657:Spata20 UTSW 11 94480609 missense probably damaging 1.00
R1712:Spata20 UTSW 11 94480514 missense probably benign
R2166:Spata20 UTSW 11 94479104 missense probably benign 0.25
R4298:Spata20 UTSW 11 94483088 missense probably damaging 0.99
R4740:Spata20 UTSW 11 94484578 missense possibly damaging 0.94
R4791:Spata20 UTSW 11 94484586 missense probably damaging 0.99
R4980:Spata20 UTSW 11 94484609 missense probably damaging 1.00
R5894:Spata20 UTSW 11 94483618 missense probably damaging 0.98
R6373:Spata20 UTSW 11 94483400 missense probably benign
R7400:Spata20 UTSW 11 94483400 missense probably benign
R7439:Spata20 UTSW 11 94484041 missense probably benign 0.02
R7441:Spata20 UTSW 11 94484041 missense probably benign 0.02
R7562:Spata20 UTSW 11 94482553 missense probably benign 0.31
R8036:Spata20 UTSW 11 94479137 missense probably benign 0.17
R8060:Spata20 UTSW 11 94482239 missense probably benign
R8335:Spata20 UTSW 11 94482543 missense probably benign 0.05
R8447:Spata20 UTSW 11 94482254 missense probably damaging 1.00
R8676:Spata20 UTSW 11 94481781 missense probably damaging 1.00
R9492:Spata20 UTSW 11 94483618 missense probably damaging 0.98
Z1176:Spata20 UTSW 11 94480535 missense probably benign 0.45
Z1177:Spata20 UTSW 11 94483139 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CCGATGCTCATTATATAGGTCAGGG -3'
(R):5'- GAGTTGGCTTCCGAACAGTG -3'

Sequencing Primer
(F):5'- CTCATTATATAGGTCAGGGTCAGAG -3'
(R):5'- GCTTCCGAACAGTGTTGATGAGAATC -3'
Posted On 2020-09-15