Incidental Mutation 'R7974:Hdac9'
ID 650793
Institutional Source Beutler Lab
Gene Symbol Hdac9
Ensembl Gene ENSMUSG00000004698
Gene Name histone deacetylase 9
Synonyms HDRP, Mitr, Hdac7b, D030072B18Rik
MMRRC Submission 046017-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7974 (G1)
Quality Score 225.009
Status Validated
Chromosome 12
Chromosomal Location 34097579-34967094 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 34353219 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Glycine at position 664 (S664G)
Ref Sequence ENSEMBL: ENSMUSP00000148029 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000209750] [ENSMUST00000209902] [ENSMUST00000209990] [ENSMUST00000210724] [ENSMUST00000211752]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000209750
AA Change: S664G

PolyPhen 2 Score 0.871 (Sensitivity: 0.83; Specificity: 0.93)
Predicted Effect possibly damaging
Transcript: ENSMUST00000209902
AA Change: S661G

PolyPhen 2 Score 0.871 (Sensitivity: 0.83; Specificity: 0.93)
Predicted Effect probably damaging
Transcript: ENSMUST00000209990
AA Change: S620G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect unknown
Transcript: ENSMUST00000210724
AA Change: S574G
Predicted Effect probably damaging
Transcript: ENSMUST00000211752
AA Change: S685G

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (64/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Histones play a critical role in transcriptional regulation, cell cycle progression, and developmental events. Histone acetylation/deacetylation alters chromosome structure and affects transcription factor access to DNA. The protein encoded by this gene has sequence homology to members of the histone deacetylase family. This gene is orthologous to the Xenopus and mouse MITR genes. The MITR protein lacks the histone deacetylase catalytic domain. It represses MEF2 activity through recruitment of multicomponent corepressor complexes that include CtBP and HDACs. This encoded protein may play a role in hematopoiesis. Multiple alternatively spliced transcripts have been described for this gene but the full-length nature of some of them has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene display age dependent cardiac hypertrophy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim1 C T 19: 57,033,405 (GRCm39) probably null Het
Adamts19 A T 18: 59,144,094 (GRCm39) Q892L possibly damaging Het
Adamts9 A G 6: 92,886,668 (GRCm39) probably null Het
Aftph T C 11: 20,648,233 (GRCm39) *686W probably null Het
AI661453 T C 17: 47,777,006 (GRCm39) L244P unknown Het
Ankar C A 1: 72,738,138 (GRCm39) E15* probably null Het
Ankrd39 A G 1: 36,585,999 (GRCm39) probably benign Het
Arsi A G 18: 61,045,478 (GRCm39) D56G probably damaging Het
Blmh T C 11: 76,856,729 (GRCm39) I245T possibly damaging Het
Ccr6 T C 17: 8,475,056 (GRCm39) F87S probably damaging Het
Cdc42ep2 T C 19: 5,968,523 (GRCm39) K61E probably damaging Het
Celsr1 C T 15: 85,915,231 (GRCm39) G914D probably damaging Het
Cep126 T A 9: 8,120,764 (GRCm39) K86N probably benign Het
Cfap70 A T 14: 20,470,818 (GRCm39) F532I probably damaging Het
Cpsf3 T A 12: 21,358,006 (GRCm39) L506Q probably damaging Het
Dct A C 14: 118,277,067 (GRCm39) I273S probably damaging Het
Dsel T C 1: 111,788,229 (GRCm39) I769V probably benign Het
Dus2 G A 8: 106,762,652 (GRCm39) E138K probably benign Het
Emsy A G 7: 98,279,425 (GRCm39) S305P possibly damaging Het
Erp27 A T 6: 136,885,063 (GRCm39) V245D probably damaging Het
Fez1 C A 9: 36,755,244 (GRCm39) T81K probably damaging Het
Gli3 A C 13: 15,900,841 (GRCm39) Q1409H probably benign Het
Hibadh A G 6: 52,534,880 (GRCm39) S167P probably benign Het
Hsdl1 A G 8: 120,293,072 (GRCm39) V121A probably benign Het
Ift70a1 T C 2: 75,810,688 (GRCm39) H465R probably damaging Het
Ighv1-18 A C 12: 114,646,669 (GRCm39) I6S possibly damaging Het
Iqcm T A 8: 76,281,520 (GRCm39) M1K probably null Het
Itch T C 2: 155,034,079 (GRCm39) F417S probably damaging Het
Itpr1 C T 6: 108,500,366 (GRCm39) T2653I possibly damaging Het
Kank1 T G 19: 25,401,584 (GRCm39) Y1064D probably damaging Het
Kmt2c T C 5: 25,505,561 (GRCm39) Q3249R probably damaging Het
Lefty1 T C 1: 180,765,385 (GRCm39) C318R probably damaging Het
Lmbr1l C T 15: 98,809,500 (GRCm39) V147I probably benign Het
Meig1 C A 2: 3,412,911 (GRCm39) E37* probably null Het
Mpp3 A G 11: 101,899,180 (GRCm39) probably null Het
Muc17 T C 5: 137,175,664 (GRCm39) N2S Het
Mup7 T C 4: 60,067,518 (GRCm39) E199G possibly damaging Het
Nol4 G C 18: 22,852,082 (GRCm39) Y275* probably null Het
Nrxn1 G A 17: 91,008,207 (GRCm39) P429S probably damaging Het
Or14j8 T C 17: 38,263,672 (GRCm39) Y81C probably damaging Het
Pfkl A T 10: 77,829,996 (GRCm39) F367L probably damaging Het
Pik3cg T C 12: 32,254,031 (GRCm39) E652G probably benign Het
Prkag3 A G 1: 74,783,980 (GRCm39) I301T probably benign Het
Rcn1 G A 2: 105,224,055 (GRCm39) P163L probably benign Het
Slc1a7 G A 4: 107,869,473 (GRCm39) V513M probably benign Het
Slc37a2 A T 9: 37,150,421 (GRCm39) probably null Het
Slc9b1 C T 3: 135,099,791 (GRCm39) T437I possibly damaging Het
Smap1 T G 1: 23,888,522 (GRCm39) T248P probably benign Het
Smpd3 A C 8: 106,982,254 (GRCm39) C617G probably benign Het
Spata20 T C 11: 94,374,966 (GRCm39) N212S possibly damaging Het
Sphkap A C 1: 83,256,683 (GRCm39) C355W probably damaging Het
Spopfm2 T C 3: 94,082,848 (GRCm39) K321R probably benign Het
Spsb1 T A 4: 149,991,566 (GRCm39) M1L probably damaging Het
Srebf2 C T 15: 82,062,966 (GRCm39) R468C probably damaging Het
Stxbp5 A C 10: 9,646,439 (GRCm39) probably null Het
Taar5 G C 10: 23,847,120 (GRCm39) D173H possibly damaging Het
Tfrc A G 16: 32,440,101 (GRCm39) D438G probably null Het
Tinag A T 9: 76,907,131 (GRCm39) I368K probably benign Het
Tm9sf1 A G 14: 55,873,906 (GRCm39) W531R probably damaging Het
Tnc G T 4: 63,918,961 (GRCm39) P1154Q possibly damaging Het
Toporsl A G 4: 52,611,645 (GRCm39) R513G probably damaging Het
Vat1 A G 11: 101,356,956 (GRCm39) S2P probably benign Het
Vmn2r107 C G 17: 20,577,270 (GRCm39) P423A probably benign Het
Vmn2r2 T A 3: 64,024,808 (GRCm39) E591V probably damaging Het
Vmn2r62 T A 7: 42,437,281 (GRCm39) Y401F probably damaging Het
Vmn2r62 G A 7: 42,414,031 (GRCm39) T804I probably damaging Het
Vmn2r89 A T 14: 51,693,459 (GRCm39) I270F probably damaging Het
Zfp418 T C 7: 7,185,167 (GRCm39) F377L possibly damaging Het
Zkscan5 T C 5: 145,144,502 (GRCm39) S182P unknown Het
Other mutations in Hdac9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01317:Hdac9 APN 12 34,479,488 (GRCm39) splice site probably benign
IGL01484:Hdac9 APN 12 34,487,164 (GRCm39) missense probably damaging 1.00
IGL02010:Hdac9 APN 12 34,481,944 (GRCm39) missense probably damaging 1.00
IGL02059:Hdac9 APN 12 34,481,967 (GRCm39) missense probably damaging 0.97
IGL02276:Hdac9 APN 12 34,481,925 (GRCm39) missense probably damaging 1.00
IGL02797:Hdac9 APN 12 34,443,273 (GRCm39) splice site probably benign
IGL03202:Hdac9 APN 12 34,423,950 (GRCm39) missense probably damaging 1.00
PIT4468001:Hdac9 UTSW 12 34,145,933 (GRCm39) missense unknown
R0304:Hdac9 UTSW 12 34,424,110 (GRCm39) missense probably damaging 1.00
R0432:Hdac9 UTSW 12 34,487,221 (GRCm39) missense probably damaging 1.00
R0659:Hdac9 UTSW 12 34,487,221 (GRCm39) missense probably damaging 1.00
R1826:Hdac9 UTSW 12 34,479,491 (GRCm39) splice site probably benign
R1879:Hdac9 UTSW 12 34,440,332 (GRCm39) missense probably damaging 0.98
R1942:Hdac9 UTSW 12 34,479,544 (GRCm39) missense probably damaging 1.00
R2113:Hdac9 UTSW 12 34,439,331 (GRCm39) missense probably damaging 1.00
R2151:Hdac9 UTSW 12 34,440,255 (GRCm39) missense probably damaging 1.00
R2216:Hdac9 UTSW 12 34,479,516 (GRCm39) missense probably damaging 1.00
R2224:Hdac9 UTSW 12 34,457,801 (GRCm39) missense probably benign 0.09
R2225:Hdac9 UTSW 12 34,457,801 (GRCm39) missense probably benign 0.09
R2227:Hdac9 UTSW 12 34,457,801 (GRCm39) missense probably benign 0.09
R3500:Hdac9 UTSW 12 34,487,352 (GRCm39) missense probably benign 0.01
R4441:Hdac9 UTSW 12 34,439,375 (GRCm39) missense probably damaging 1.00
R4674:Hdac9 UTSW 12 34,423,959 (GRCm39) missense possibly damaging 0.96
R4694:Hdac9 UTSW 12 34,487,246 (GRCm39) missense probably damaging 1.00
R5033:Hdac9 UTSW 12 34,423,906 (GRCm39) missense probably benign
R5229:Hdac9 UTSW 12 34,487,163 (GRCm39) missense probably damaging 1.00
R5353:Hdac9 UTSW 12 34,443,392 (GRCm39) nonsense probably null
R5384:Hdac9 UTSW 12 34,479,557 (GRCm39) missense probably damaging 1.00
R5958:Hdac9 UTSW 12 34,423,882 (GRCm39) missense probably damaging 0.97
R6129:Hdac9 UTSW 12 34,337,474 (GRCm39) missense probably damaging 1.00
R6157:Hdac9 UTSW 12 34,439,428 (GRCm39) missense probably damaging 1.00
R6248:Hdac9 UTSW 12 34,578,293 (GRCm39) missense possibly damaging 0.79
R6333:Hdac9 UTSW 12 34,102,323 (GRCm39) missense probably damaging 0.98
R6474:Hdac9 UTSW 12 34,481,990 (GRCm39) critical splice acceptor site probably null
R6589:Hdac9 UTSW 12 34,265,028 (GRCm39) missense probably damaging 1.00
R6737:Hdac9 UTSW 12 34,265,451 (GRCm39) missense probably damaging 1.00
R6767:Hdac9 UTSW 12 34,337,528 (GRCm39) missense probably damaging 1.00
R6837:Hdac9 UTSW 12 34,337,463 (GRCm39) missense probably benign 0.12
R6857:Hdac9 UTSW 12 34,443,362 (GRCm39) missense probably benign 0.37
R7069:Hdac9 UTSW 12 34,479,548 (GRCm39) missense possibly damaging 0.92
R7237:Hdac9 UTSW 12 34,424,139 (GRCm39) critical splice acceptor site probably null
R7768:Hdac9 UTSW 12 34,440,239 (GRCm39) missense possibly damaging 0.81
R7917:Hdac9 UTSW 12 34,483,209 (GRCm39) missense probably benign 0.31
R7990:Hdac9 UTSW 12 34,265,452 (GRCm39) missense probably benign 0.05
R8489:Hdac9 UTSW 12 34,487,180 (GRCm39) missense probably damaging 1.00
R8683:Hdac9 UTSW 12 34,440,220 (GRCm39) missense probably damaging 1.00
R9208:Hdac9 UTSW 12 34,220,101 (GRCm39) missense probably benign 0.01
R9397:Hdac9 UTSW 12 34,353,275 (GRCm39) missense probably damaging 0.99
R9431:Hdac9 UTSW 12 34,440,327 (GRCm39) nonsense probably null
R9629:Hdac9 UTSW 12 34,439,389 (GRCm39) missense probably damaging 0.99
R9646:Hdac9 UTSW 12 34,487,167 (GRCm39) missense probably damaging 1.00
R9709:Hdac9 UTSW 12 34,362,602 (GRCm39) missense probably benign 0.21
Z1088:Hdac9 UTSW 12 34,457,788 (GRCm39) missense probably damaging 1.00
Z1176:Hdac9 UTSW 12 34,423,986 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- CCAAGAACCTACTGTGCGAC -3'
(R):5'- CCTGGTTCTGAGAACTACCTC -3'

Sequencing Primer
(F):5'- AAGCTCGGTGGCACTTG -3'
(R):5'- GATGCTGAAACACCAGTG -3'
Posted On 2020-09-15