Incidental Mutation 'R7974:Ighv1-18'
ID650794
Institutional Source Beutler Lab
Gene Symbol Ighv1-18
Ensembl Gene ENSMUSG00000076695
Gene Nameimmunoglobulin heavy variable V1-18
SynonymsGm16856
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.107) question?
Stock #R7974 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location114682632-114683065 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 114683049 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Serine at position 6 (I6S)
Ref Sequence ENSEMBL: ENSMUSP00000142064 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103504] [ENSMUST00000194350]
Predicted Effect probably damaging
Transcript: ENSMUST00000103504
AA Change: I6S

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000100285
Gene: ENSMUSG00000076695
AA Change: I6S

DomainStartEndE-ValueType
Pfam:V-set 18 102 9.3e-13 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000194350
AA Change: I6S

PolyPhen 2 Score 0.491 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000142064
Gene: ENSMUSG00000076695
AA Change: I6S

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IGv 36 117 2.4e-29 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (64/64)
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim1 C T 19: 57,044,973 probably null Het
Adamts19 A T 18: 59,011,022 Q892L possibly damaging Het
Adamts9 A G 6: 92,909,687 probably null Het
Aftph T C 11: 20,698,233 *686W probably null Het
AI661453 T C 17: 47,466,081 L244P unknown Het
Ankar C A 1: 72,698,979 E15* probably null Het
Ankrd39 A G 1: 36,546,918 probably benign Het
Arsi A G 18: 60,912,406 D56G probably damaging Het
Blmh T C 11: 76,965,903 I245T possibly damaging Het
Ccr6 T C 17: 8,256,224 F87S probably damaging Het
Cdc42ep2 T C 19: 5,918,495 K61E probably damaging Het
Celsr1 C T 15: 86,031,030 G914D probably damaging Het
Cep126 T A 9: 8,120,763 K86N probably benign Het
Cfap70 A T 14: 20,420,750 F532I probably damaging Het
Cpsf3 T A 12: 21,308,005 L506Q probably damaging Het
Dct A C 14: 118,039,655 I273S probably damaging Het
Dsel T C 1: 111,860,499 I769V probably benign Het
Dus2 G A 8: 106,036,020 E138K probably benign Het
Emsy A G 7: 98,630,218 S305P possibly damaging Het
Erp27 A T 6: 136,908,065 V245D probably damaging Het
Fez1 C A 9: 36,843,948 T81K probably damaging Het
Gli3 A C 13: 15,726,256 Q1409H probably benign Het
Gm10696 T C 3: 94,175,541 K321R probably benign Het
Hdac9 T C 12: 34,303,220 S664G possibly damaging Het
Hibadh A G 6: 52,557,895 S167P probably benign Het
Hsdl1 A G 8: 119,566,333 V121A probably benign Het
Iqcm T A 8: 75,554,892 M1K probably null Het
Itch T C 2: 155,192,159 F417S probably damaging Het
Itpr1 C T 6: 108,523,405 T2653I possibly damaging Het
Kank1 T G 19: 25,424,220 Y1064D probably damaging Het
Kmt2c T C 5: 25,300,563 Q3249R probably damaging Het
Lefty1 T C 1: 180,937,820 C318R probably damaging Het
Lmbr1l C T 15: 98,911,619 V147I probably benign Het
Meig1 C A 2: 3,411,874 E37* probably null Het
Mpp3 A G 11: 102,008,354 probably null Het
Muc3 T C 5: 137,146,816 N2S Het
Mup7 T C 4: 60,067,518 E199G possibly damaging Het
Nol4 G C 18: 22,719,025 Y275* probably null Het
Nrxn1 G A 17: 90,700,779 P429S probably damaging Het
Olfr761 T C 17: 37,952,781 Y81C probably damaging Het
Pfkl A T 10: 77,994,162 F367L probably damaging Het
Pik3cg T C 12: 32,204,032 E652G probably benign Het
Prkag3 A G 1: 74,744,821 I301T probably benign Het
Rcn1 G A 2: 105,393,710 P163L probably benign Het
Slc1a7 G A 4: 108,012,276 V513M probably benign Het
Slc37a2 A T 9: 37,239,125 probably null Het
Slc9b1 C T 3: 135,394,030 T437I possibly damaging Het
Smap1 T G 1: 23,849,441 T248P probably benign Het
Smpd3 A C 8: 106,255,622 C617G probably benign Het
Spata20 T C 11: 94,484,140 N212S possibly damaging Het
Sphkap A C 1: 83,278,962 C355W probably damaging Het
Spsb1 T A 4: 149,907,109 M1L probably damaging Het
Srebf2 C T 15: 82,178,765 R468C probably damaging Het
Stxbp5 A C 10: 9,770,695 probably null Het
Taar5 G C 10: 23,971,222 D173H possibly damaging Het
Tfrc A G 16: 32,621,283 D438G probably null Het
Tinag A T 9: 76,999,849 I368K probably benign Het
Tm9sf1 A G 14: 55,636,449 W531R probably damaging Het
Tnc G T 4: 64,000,724 P1154Q possibly damaging Het
Toporsl A G 4: 52,611,645 R513G probably damaging Het
Ttc30a1 T C 2: 75,980,344 H465R probably damaging Het
Vat1 A G 11: 101,466,130 S2P probably benign Het
Vmn2r107 C G 17: 20,357,008 P423A probably benign Het
Vmn2r2 T A 3: 64,117,387 E591V probably damaging Het
Vmn2r62 G A 7: 42,764,607 T804I probably damaging Het
Vmn2r62 T A 7: 42,787,857 Y401F probably damaging Het
Vmn2r89 A T 14: 51,456,002 I270F probably damaging Het
Zfp418 T C 7: 7,182,168 F377L possibly damaging Het
Zkscan5 T C 5: 145,207,692 S182P unknown Het
Other mutations in Ighv1-18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03269:Ighv1-18 APN 12 114682846 missense probably damaging 1.00
R4056:Ighv1-18 UTSW 12 114682667 missense probably benign 0.26
R5766:Ighv1-18 UTSW 12 114682907 missense probably damaging 1.00
R5801:Ighv1-18 UTSW 12 114682708 missense probably damaging 1.00
R6387:Ighv1-18 UTSW 12 114682660 missense probably damaging 0.98
R6981:Ighv1-18 UTSW 12 114682678 missense probably damaging 1.00
R7703:Ighv1-18 UTSW 12 114682761 missense probably benign 0.23
R8486:Ighv1-18 UTSW 12 114682705 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GTATCTTCACTGAAGCCCCAG -3'
(R):5'- GACCATCCTACTGCTTGACC -3'

Sequencing Primer
(F):5'- GCCCCAGGCTTCACCAG -3'
(R):5'- ATCCTACTGCTTGACCTATGTAC -3'
Posted On2020-09-15