Incidental Mutation 'R7974:Cfap70'
ID 650796
Institutional Source Beutler Lab
Gene Symbol Cfap70
Ensembl Gene ENSMUSG00000039543
Gene Name cilia and flagella associated protein 70
Synonyms 5330402L21Rik, Ttc18
MMRRC Submission 046017-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.078) question?
Stock # R7974 (G1)
Quality Score 225.009
Status Validated
Chromosome 14
Chromosomal Location 20444261-20502294 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 20470818 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 532 (F532I)
Ref Sequence ENSEMBL: ENSMUSP00000056869 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022348] [ENSMUST00000022349] [ENSMUST00000056073]
AlphaFold D3YVL2
Predicted Effect probably damaging
Transcript: ENSMUST00000022348
AA Change: F532I

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000022348
Gene: ENSMUSG00000039543
AA Change: F532I

DomainStartEndE-ValueType
Blast:C2 11 122 5e-44 BLAST
low complexity region 494 503 N/A INTRINSIC
low complexity region 581 590 N/A INTRINSIC
Blast:TPR 591 623 2e-11 BLAST
Blast:TPR 624 657 3e-15 BLAST
TPR 658 691 1.73e1 SMART
Blast:TPR 693 724 2e-7 BLAST
TPR 905 938 1.26e1 SMART
TPR 939 972 5.03e-1 SMART
TPR 976 1009 2.52e-1 SMART
TPR 1043 1076 2.07e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000022349
AA Change: F476I

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000022349
Gene: ENSMUSG00000039543
AA Change: F476I

DomainStartEndE-ValueType
Blast:C2 11 122 5e-44 BLAST
low complexity region 438 447 N/A INTRINSIC
low complexity region 569 578 N/A INTRINSIC
Blast:TPR 579 611 2e-11 BLAST
Blast:TPR 612 645 3e-15 BLAST
TPR 646 679 1.73e1 SMART
Blast:TPR 681 712 2e-7 BLAST
TPR 932 965 1.26e1 SMART
TPR 966 999 5.03e-1 SMART
TPR 1003 1036 2.52e-1 SMART
TPR 1070 1103 2.07e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000056073
AA Change: F532I

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000056869
Gene: ENSMUSG00000039543
AA Change: F532I

DomainStartEndE-ValueType
Blast:C2 11 122 5e-44 BLAST
low complexity region 494 503 N/A INTRINSIC
low complexity region 625 634 N/A INTRINSIC
Blast:TPR 635 667 2e-11 BLAST
Blast:TPR 668 701 3e-15 BLAST
TPR 702 735 1.73e1 SMART
Blast:TPR 737 768 2e-7 BLAST
TPR 949 982 1.26e1 SMART
TPR 983 1016 5.03e-1 SMART
TPR 1020 1053 2.52e-1 SMART
TPR 1087 1120 2.07e1 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (64/64)
Allele List at MGI

All alleles(17) : Targeted(2) Gene trapped(15)

Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim1 C T 19: 57,033,405 (GRCm39) probably null Het
Adamts19 A T 18: 59,144,094 (GRCm39) Q892L possibly damaging Het
Adamts9 A G 6: 92,886,668 (GRCm39) probably null Het
Aftph T C 11: 20,648,233 (GRCm39) *686W probably null Het
AI661453 T C 17: 47,777,006 (GRCm39) L244P unknown Het
Ankar C A 1: 72,738,138 (GRCm39) E15* probably null Het
Ankrd39 A G 1: 36,585,999 (GRCm39) probably benign Het
Arsi A G 18: 61,045,478 (GRCm39) D56G probably damaging Het
Blmh T C 11: 76,856,729 (GRCm39) I245T possibly damaging Het
Ccr6 T C 17: 8,475,056 (GRCm39) F87S probably damaging Het
Cdc42ep2 T C 19: 5,968,523 (GRCm39) K61E probably damaging Het
Celsr1 C T 15: 85,915,231 (GRCm39) G914D probably damaging Het
Cep126 T A 9: 8,120,764 (GRCm39) K86N probably benign Het
Cpsf3 T A 12: 21,358,006 (GRCm39) L506Q probably damaging Het
Dct A C 14: 118,277,067 (GRCm39) I273S probably damaging Het
Dsel T C 1: 111,788,229 (GRCm39) I769V probably benign Het
Dus2 G A 8: 106,762,652 (GRCm39) E138K probably benign Het
Emsy A G 7: 98,279,425 (GRCm39) S305P possibly damaging Het
Erp27 A T 6: 136,885,063 (GRCm39) V245D probably damaging Het
Fez1 C A 9: 36,755,244 (GRCm39) T81K probably damaging Het
Gli3 A C 13: 15,900,841 (GRCm39) Q1409H probably benign Het
Hdac9 T C 12: 34,353,219 (GRCm39) S664G possibly damaging Het
Hibadh A G 6: 52,534,880 (GRCm39) S167P probably benign Het
Hsdl1 A G 8: 120,293,072 (GRCm39) V121A probably benign Het
Ift70a1 T C 2: 75,810,688 (GRCm39) H465R probably damaging Het
Ighv1-18 A C 12: 114,646,669 (GRCm39) I6S possibly damaging Het
Iqcm T A 8: 76,281,520 (GRCm39) M1K probably null Het
Itch T C 2: 155,034,079 (GRCm39) F417S probably damaging Het
Itpr1 C T 6: 108,500,366 (GRCm39) T2653I possibly damaging Het
Kank1 T G 19: 25,401,584 (GRCm39) Y1064D probably damaging Het
Kmt2c T C 5: 25,505,561 (GRCm39) Q3249R probably damaging Het
Lefty1 T C 1: 180,765,385 (GRCm39) C318R probably damaging Het
Lmbr1l C T 15: 98,809,500 (GRCm39) V147I probably benign Het
Meig1 C A 2: 3,412,911 (GRCm39) E37* probably null Het
Mpp3 A G 11: 101,899,180 (GRCm39) probably null Het
Muc17 T C 5: 137,175,664 (GRCm39) N2S Het
Mup7 T C 4: 60,067,518 (GRCm39) E199G possibly damaging Het
Nol4 G C 18: 22,852,082 (GRCm39) Y275* probably null Het
Nrxn1 G A 17: 91,008,207 (GRCm39) P429S probably damaging Het
Or14j8 T C 17: 38,263,672 (GRCm39) Y81C probably damaging Het
Pfkl A T 10: 77,829,996 (GRCm39) F367L probably damaging Het
Pik3cg T C 12: 32,254,031 (GRCm39) E652G probably benign Het
Prkag3 A G 1: 74,783,980 (GRCm39) I301T probably benign Het
Rcn1 G A 2: 105,224,055 (GRCm39) P163L probably benign Het
Slc1a7 G A 4: 107,869,473 (GRCm39) V513M probably benign Het
Slc37a2 A T 9: 37,150,421 (GRCm39) probably null Het
Slc9b1 C T 3: 135,099,791 (GRCm39) T437I possibly damaging Het
Smap1 T G 1: 23,888,522 (GRCm39) T248P probably benign Het
Smpd3 A C 8: 106,982,254 (GRCm39) C617G probably benign Het
Spata20 T C 11: 94,374,966 (GRCm39) N212S possibly damaging Het
Sphkap A C 1: 83,256,683 (GRCm39) C355W probably damaging Het
Spopfm2 T C 3: 94,082,848 (GRCm39) K321R probably benign Het
Spsb1 T A 4: 149,991,566 (GRCm39) M1L probably damaging Het
Srebf2 C T 15: 82,062,966 (GRCm39) R468C probably damaging Het
Stxbp5 A C 10: 9,646,439 (GRCm39) probably null Het
Taar5 G C 10: 23,847,120 (GRCm39) D173H possibly damaging Het
Tfrc A G 16: 32,440,101 (GRCm39) D438G probably null Het
Tinag A T 9: 76,907,131 (GRCm39) I368K probably benign Het
Tm9sf1 A G 14: 55,873,906 (GRCm39) W531R probably damaging Het
Tnc G T 4: 63,918,961 (GRCm39) P1154Q possibly damaging Het
Toporsl A G 4: 52,611,645 (GRCm39) R513G probably damaging Het
Vat1 A G 11: 101,356,956 (GRCm39) S2P probably benign Het
Vmn2r107 C G 17: 20,577,270 (GRCm39) P423A probably benign Het
Vmn2r2 T A 3: 64,024,808 (GRCm39) E591V probably damaging Het
Vmn2r62 T A 7: 42,437,281 (GRCm39) Y401F probably damaging Het
Vmn2r62 G A 7: 42,414,031 (GRCm39) T804I probably damaging Het
Vmn2r89 A T 14: 51,693,459 (GRCm39) I270F probably damaging Het
Zfp418 T C 7: 7,185,167 (GRCm39) F377L possibly damaging Het
Zkscan5 T C 5: 145,144,502 (GRCm39) S182P unknown Het
Other mutations in Cfap70
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00468:Cfap70 APN 14 20,462,530 (GRCm39) missense possibly damaging 0.77
IGL00567:Cfap70 APN 14 20,444,748 (GRCm39) missense probably benign 0.30
IGL00773:Cfap70 APN 14 20,497,602 (GRCm39) missense probably damaging 1.00
IGL01061:Cfap70 APN 14 20,497,693 (GRCm39) splice site probably benign
IGL01520:Cfap70 APN 14 20,470,755 (GRCm39) missense probably benign 0.23
IGL01665:Cfap70 APN 14 20,453,186 (GRCm39) missense probably damaging 1.00
IGL01918:Cfap70 APN 14 20,475,467 (GRCm39) missense possibly damaging 0.81
IGL02211:Cfap70 APN 14 20,445,040 (GRCm39) missense probably damaging 1.00
IGL02613:Cfap70 APN 14 20,459,132 (GRCm39) splice site probably null
IGL03142:Cfap70 APN 14 20,447,283 (GRCm39) missense probably damaging 0.99
IGL03354:Cfap70 APN 14 20,482,050 (GRCm39) missense probably damaging 1.00
IGL03047:Cfap70 UTSW 14 20,498,646 (GRCm39) missense possibly damaging 0.92
IGL03097:Cfap70 UTSW 14 20,498,676 (GRCm39) missense probably benign 0.00
P0008:Cfap70 UTSW 14 20,466,600 (GRCm39) missense probably damaging 0.99
P0035:Cfap70 UTSW 14 20,474,539 (GRCm39) splice site probably benign
R0200:Cfap70 UTSW 14 20,498,631 (GRCm39) missense probably damaging 0.96
R0207:Cfap70 UTSW 14 20,462,415 (GRCm39) missense probably damaging 1.00
R0238:Cfap70 UTSW 14 20,498,673 (GRCm39) missense probably benign 0.01
R0238:Cfap70 UTSW 14 20,498,673 (GRCm39) missense probably benign 0.01
R0239:Cfap70 UTSW 14 20,498,673 (GRCm39) missense probably benign 0.01
R0239:Cfap70 UTSW 14 20,498,673 (GRCm39) missense probably benign 0.01
R0463:Cfap70 UTSW 14 20,498,631 (GRCm39) missense probably damaging 0.96
R0608:Cfap70 UTSW 14 20,498,631 (GRCm39) missense probably damaging 0.96
R0703:Cfap70 UTSW 14 20,489,783 (GRCm39) missense probably damaging 1.00
R0919:Cfap70 UTSW 14 20,454,232 (GRCm39) missense probably benign 0.00
R0928:Cfap70 UTSW 14 20,493,987 (GRCm39) missense probably damaging 1.00
R1595:Cfap70 UTSW 14 20,497,604 (GRCm39) missense probably benign 0.10
R1667:Cfap70 UTSW 14 20,454,225 (GRCm39) missense probably benign 0.41
R1799:Cfap70 UTSW 14 20,445,067 (GRCm39) missense probably damaging 1.00
R1869:Cfap70 UTSW 14 20,458,678 (GRCm39) nonsense probably null
R1920:Cfap70 UTSW 14 20,445,020 (GRCm39) missense probably damaging 1.00
R1968:Cfap70 UTSW 14 20,470,879 (GRCm39) missense possibly damaging 0.93
R2173:Cfap70 UTSW 14 20,458,630 (GRCm39) missense probably benign 0.00
R3081:Cfap70 UTSW 14 20,470,830 (GRCm39) missense probably damaging 1.00
R3813:Cfap70 UTSW 14 20,471,190 (GRCm39) missense possibly damaging 0.95
R3979:Cfap70 UTSW 14 20,489,787 (GRCm39) missense probably benign 0.11
R4093:Cfap70 UTSW 14 20,459,181 (GRCm39) missense probably damaging 1.00
R4271:Cfap70 UTSW 14 20,470,793 (GRCm39) missense probably benign 0.00
R4604:Cfap70 UTSW 14 20,493,729 (GRCm39) missense probably benign 0.01
R4839:Cfap70 UTSW 14 20,475,597 (GRCm39) missense probably damaging 0.96
R6387:Cfap70 UTSW 14 20,498,643 (GRCm39) missense probably damaging 1.00
R6464:Cfap70 UTSW 14 20,451,107 (GRCm39) splice site probably null
R6915:Cfap70 UTSW 14 20,459,153 (GRCm39) missense probably benign 0.17
R7317:Cfap70 UTSW 14 20,450,502 (GRCm39) missense possibly damaging 0.78
R7400:Cfap70 UTSW 14 20,458,335 (GRCm39) missense probably benign
R7962:Cfap70 UTSW 14 20,486,854 (GRCm39) missense probably benign 0.00
R7996:Cfap70 UTSW 14 20,459,194 (GRCm39) missense probably benign 0.02
R8897:Cfap70 UTSW 14 20,493,669 (GRCm39) critical splice donor site probably null
R9116:Cfap70 UTSW 14 20,497,590 (GRCm39) missense probably benign 0.01
R9174:Cfap70 UTSW 14 20,493,706 (GRCm39) missense probably damaging 1.00
R9649:Cfap70 UTSW 14 20,450,546 (GRCm39) missense probably damaging 0.99
R9667:Cfap70 UTSW 14 20,490,690 (GRCm39) critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GTGTTCCACTGGCTGATAGAAAAC -3'
(R):5'- AGCTCTTCAGTGTGGCTTCC -3'

Sequencing Primer
(F):5'- CCACTGGCTGATAGAAAACTTAAAG -3'
(R):5'- GCATCTGTGATCAATGAATCCTGTGC -3'
Posted On 2020-09-15