Incidental Mutation 'R7974:Lmbr1l'
ID 650802
Institutional Source Beutler Lab
Gene Symbol Lmbr1l
Ensembl Gene ENSMUSG00000022999
Gene Name limb region 1 like
Synonyms D15Ertd735e, 1110013E13Rik
MMRRC Submission 046017-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7974 (G1)
Quality Score 225.009
Status Validated
Chromosome 15
Chromosomal Location 98801798-98815944 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 98809500 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Isoleucine at position 147 (V147I)
Ref Sequence ENSEMBL: ENSMUSP00000023736 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023736]
AlphaFold Q9D1E5
Predicted Effect probably benign
Transcript: ENSMUST00000023736
AA Change: V147I

PolyPhen 2 Score 0.033 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000023736
Gene: ENSMUSG00000022999
AA Change: V147I

DomainStartEndE-ValueType
Pfam:LMBR1 28 269 2e-41 PFAM
Pfam:LMBR1 266 450 1.2e-35 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (64/64)
MGI Phenotype PHENOTYPE: Mice homozygous for a gene disruption display normal morphology, clinical chemistry, hematology, and behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim1 C T 19: 57,033,405 (GRCm39) probably null Het
Adamts19 A T 18: 59,144,094 (GRCm39) Q892L possibly damaging Het
Adamts9 A G 6: 92,886,668 (GRCm39) probably null Het
Aftph T C 11: 20,648,233 (GRCm39) *686W probably null Het
AI661453 T C 17: 47,777,006 (GRCm39) L244P unknown Het
Ankar C A 1: 72,738,138 (GRCm39) E15* probably null Het
Ankrd39 A G 1: 36,585,999 (GRCm39) probably benign Het
Arsi A G 18: 61,045,478 (GRCm39) D56G probably damaging Het
Blmh T C 11: 76,856,729 (GRCm39) I245T possibly damaging Het
Ccr6 T C 17: 8,475,056 (GRCm39) F87S probably damaging Het
Cdc42ep2 T C 19: 5,968,523 (GRCm39) K61E probably damaging Het
Celsr1 C T 15: 85,915,231 (GRCm39) G914D probably damaging Het
Cep126 T A 9: 8,120,764 (GRCm39) K86N probably benign Het
Cfap70 A T 14: 20,470,818 (GRCm39) F532I probably damaging Het
Cpsf3 T A 12: 21,358,006 (GRCm39) L506Q probably damaging Het
Dct A C 14: 118,277,067 (GRCm39) I273S probably damaging Het
Dsel T C 1: 111,788,229 (GRCm39) I769V probably benign Het
Dus2 G A 8: 106,762,652 (GRCm39) E138K probably benign Het
Emsy A G 7: 98,279,425 (GRCm39) S305P possibly damaging Het
Erp27 A T 6: 136,885,063 (GRCm39) V245D probably damaging Het
Fez1 C A 9: 36,755,244 (GRCm39) T81K probably damaging Het
Gli3 A C 13: 15,900,841 (GRCm39) Q1409H probably benign Het
Hdac9 T C 12: 34,353,219 (GRCm39) S664G possibly damaging Het
Hibadh A G 6: 52,534,880 (GRCm39) S167P probably benign Het
Hsdl1 A G 8: 120,293,072 (GRCm39) V121A probably benign Het
Ift70a1 T C 2: 75,810,688 (GRCm39) H465R probably damaging Het
Ighv1-18 A C 12: 114,646,669 (GRCm39) I6S possibly damaging Het
Iqcm T A 8: 76,281,520 (GRCm39) M1K probably null Het
Itch T C 2: 155,034,079 (GRCm39) F417S probably damaging Het
Itpr1 C T 6: 108,500,366 (GRCm39) T2653I possibly damaging Het
Kank1 T G 19: 25,401,584 (GRCm39) Y1064D probably damaging Het
Kmt2c T C 5: 25,505,561 (GRCm39) Q3249R probably damaging Het
Lefty1 T C 1: 180,765,385 (GRCm39) C318R probably damaging Het
Meig1 C A 2: 3,412,911 (GRCm39) E37* probably null Het
Mpp3 A G 11: 101,899,180 (GRCm39) probably null Het
Muc17 T C 5: 137,175,664 (GRCm39) N2S Het
Mup7 T C 4: 60,067,518 (GRCm39) E199G possibly damaging Het
Nol4 G C 18: 22,852,082 (GRCm39) Y275* probably null Het
Nrxn1 G A 17: 91,008,207 (GRCm39) P429S probably damaging Het
Or14j8 T C 17: 38,263,672 (GRCm39) Y81C probably damaging Het
Pfkl A T 10: 77,829,996 (GRCm39) F367L probably damaging Het
Pik3cg T C 12: 32,254,031 (GRCm39) E652G probably benign Het
Prkag3 A G 1: 74,783,980 (GRCm39) I301T probably benign Het
Rcn1 G A 2: 105,224,055 (GRCm39) P163L probably benign Het
Slc1a7 G A 4: 107,869,473 (GRCm39) V513M probably benign Het
Slc37a2 A T 9: 37,150,421 (GRCm39) probably null Het
Slc9b1 C T 3: 135,099,791 (GRCm39) T437I possibly damaging Het
Smap1 T G 1: 23,888,522 (GRCm39) T248P probably benign Het
Smpd3 A C 8: 106,982,254 (GRCm39) C617G probably benign Het
Spata20 T C 11: 94,374,966 (GRCm39) N212S possibly damaging Het
Sphkap A C 1: 83,256,683 (GRCm39) C355W probably damaging Het
Spopfm2 T C 3: 94,082,848 (GRCm39) K321R probably benign Het
Spsb1 T A 4: 149,991,566 (GRCm39) M1L probably damaging Het
Srebf2 C T 15: 82,062,966 (GRCm39) R468C probably damaging Het
Stxbp5 A C 10: 9,646,439 (GRCm39) probably null Het
Taar5 G C 10: 23,847,120 (GRCm39) D173H possibly damaging Het
Tfrc A G 16: 32,440,101 (GRCm39) D438G probably null Het
Tinag A T 9: 76,907,131 (GRCm39) I368K probably benign Het
Tm9sf1 A G 14: 55,873,906 (GRCm39) W531R probably damaging Het
Tnc G T 4: 63,918,961 (GRCm39) P1154Q possibly damaging Het
Toporsl A G 4: 52,611,645 (GRCm39) R513G probably damaging Het
Vat1 A G 11: 101,356,956 (GRCm39) S2P probably benign Het
Vmn2r107 C G 17: 20,577,270 (GRCm39) P423A probably benign Het
Vmn2r2 T A 3: 64,024,808 (GRCm39) E591V probably damaging Het
Vmn2r62 T A 7: 42,437,281 (GRCm39) Y401F probably damaging Het
Vmn2r62 G A 7: 42,414,031 (GRCm39) T804I probably damaging Het
Vmn2r89 A T 14: 51,693,459 (GRCm39) I270F probably damaging Het
Zfp418 T C 7: 7,185,167 (GRCm39) F377L possibly damaging Het
Zkscan5 T C 5: 145,144,502 (GRCm39) S182P unknown Het
Other mutations in Lmbr1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02002:Lmbr1l APN 15 98,802,666 (GRCm39) missense probably damaging 1.00
IGL02097:Lmbr1l APN 15 98,815,772 (GRCm39) missense probably damaging 0.98
IGL02731:Lmbr1l APN 15 98,815,777 (GRCm39) missense probably damaging 0.96
finch UTSW 15 98,807,267 (GRCm39) critical splice donor site probably null
Gooseberry UTSW 15 98,810,308 (GRCm39) missense probably damaging 0.99
junco UTSW 15 98,810,408 (GRCm39) missense probably damaging 1.00
morula UTSW 15 98,802,672 (GRCm39) missense probably damaging 1.00
munia UTSW 15 98,807,150 (GRCm39) critical splice acceptor site probably null
strawberry UTSW 15 98,807,144 (GRCm39) nonsense probably null
R0310:Lmbr1l UTSW 15 98,806,654 (GRCm39) splice site probably benign
R1778:Lmbr1l UTSW 15 98,810,357 (GRCm39) missense probably damaging 1.00
R2418:Lmbr1l UTSW 15 98,805,418 (GRCm39) missense possibly damaging 0.89
R2419:Lmbr1l UTSW 15 98,805,418 (GRCm39) missense possibly damaging 0.89
R4181:Lmbr1l UTSW 15 98,806,601 (GRCm39) missense possibly damaging 0.94
R4379:Lmbr1l UTSW 15 98,807,144 (GRCm39) nonsense probably null
R4472:Lmbr1l UTSW 15 98,804,178 (GRCm39) missense probably benign 0.02
R5290:Lmbr1l UTSW 15 98,810,123 (GRCm39) missense probably damaging 1.00
R5410:Lmbr1l UTSW 15 98,807,143 (GRCm39) missense probably damaging 1.00
R5436:Lmbr1l UTSW 15 98,802,672 (GRCm39) missense probably damaging 1.00
R5667:Lmbr1l UTSW 15 98,805,489 (GRCm39) missense possibly damaging 0.88
R5671:Lmbr1l UTSW 15 98,805,489 (GRCm39) missense possibly damaging 0.88
R5918:Lmbr1l UTSW 15 98,810,308 (GRCm39) missense probably damaging 0.99
R6735:Lmbr1l UTSW 15 98,807,121 (GRCm39) missense probably damaging 1.00
R6882:Lmbr1l UTSW 15 98,805,467 (GRCm39) missense probably damaging 0.99
R7131:Lmbr1l UTSW 15 98,804,204 (GRCm39) missense probably benign 0.05
R7136:Lmbr1l UTSW 15 98,809,372 (GRCm39) splice site probably null
R7169:Lmbr1l UTSW 15 98,807,075 (GRCm39) critical splice donor site probably benign
R7169:Lmbr1l UTSW 15 98,807,039 (GRCm39) frame shift probably null
R7336:Lmbr1l UTSW 15 98,811,468 (GRCm39) missense possibly damaging 0.94
R7541:Lmbr1l UTSW 15 98,807,267 (GRCm39) critical splice donor site probably null
R7603:Lmbr1l UTSW 15 98,806,572 (GRCm39) nonsense probably null
R8354:Lmbr1l UTSW 15 98,810,357 (GRCm39) missense probably damaging 1.00
R8454:Lmbr1l UTSW 15 98,810,357 (GRCm39) missense probably damaging 1.00
R8504:Lmbr1l UTSW 15 98,810,065 (GRCm39) missense probably damaging 0.97
R8933:Lmbr1l UTSW 15 98,807,150 (GRCm39) critical splice acceptor site probably null
R8974:Lmbr1l UTSW 15 98,810,408 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGGATGAGGACAGCTTGAAAC -3'
(R):5'- TAGTGCTGCCAAAATCAGGAG -3'

Sequencing Primer
(F):5'- GCTTGAAACCTCTGAAGCTG -3'
(R):5'- CTGCCAAAATCAGGAGGAGGC -3'
Posted On 2020-09-15