Incidental Mutation 'R7974:Or14j8'
ID 650807
Institutional Source Beutler Lab
Gene Symbol Or14j8
Ensembl Gene ENSMUSG00000109376
Gene Name olfactory receptor family 14 subfamily J member 8
Synonyms Olfr1552-ps1, MOR218-6P, GA_x6K02T2PSCP-2403971-2403000, Olfr761, MOR218-12, MOR218-5P, MOR218-6P
MMRRC Submission 046017-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.784) question?
Stock # R7974 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 38262942-38263913 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 38263672 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 81 (Y81C)
Ref Sequence ENSEMBL: ENSMUSP00000092917 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049620]
AlphaFold Q7TRJ0
Predicted Effect probably damaging
Transcript: ENSMUST00000049620
AA Change: Y81C

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000092917
Gene: ENSMUSG00000109376
AA Change: Y81C

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 6.8e-45 PFAM
Pfam:7TM_GPCR_Srsx 35 305 2.1e-6 PFAM
Pfam:7tm_1 41 290 3.7e-22 PFAM
Meta Mutation Damage Score 0.6329 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (64/64)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim1 C T 19: 57,033,405 (GRCm39) probably null Het
Adamts19 A T 18: 59,144,094 (GRCm39) Q892L possibly damaging Het
Adamts9 A G 6: 92,886,668 (GRCm39) probably null Het
Aftph T C 11: 20,648,233 (GRCm39) *686W probably null Het
AI661453 T C 17: 47,777,006 (GRCm39) L244P unknown Het
Ankar C A 1: 72,738,138 (GRCm39) E15* probably null Het
Ankrd39 A G 1: 36,585,999 (GRCm39) probably benign Het
Arsi A G 18: 61,045,478 (GRCm39) D56G probably damaging Het
Blmh T C 11: 76,856,729 (GRCm39) I245T possibly damaging Het
Ccr6 T C 17: 8,475,056 (GRCm39) F87S probably damaging Het
Cdc42ep2 T C 19: 5,968,523 (GRCm39) K61E probably damaging Het
Celsr1 C T 15: 85,915,231 (GRCm39) G914D probably damaging Het
Cep126 T A 9: 8,120,764 (GRCm39) K86N probably benign Het
Cfap70 A T 14: 20,470,818 (GRCm39) F532I probably damaging Het
Cpsf3 T A 12: 21,358,006 (GRCm39) L506Q probably damaging Het
Dct A C 14: 118,277,067 (GRCm39) I273S probably damaging Het
Dsel T C 1: 111,788,229 (GRCm39) I769V probably benign Het
Dus2 G A 8: 106,762,652 (GRCm39) E138K probably benign Het
Emsy A G 7: 98,279,425 (GRCm39) S305P possibly damaging Het
Erp27 A T 6: 136,885,063 (GRCm39) V245D probably damaging Het
Fez1 C A 9: 36,755,244 (GRCm39) T81K probably damaging Het
Gli3 A C 13: 15,900,841 (GRCm39) Q1409H probably benign Het
Hdac9 T C 12: 34,353,219 (GRCm39) S664G possibly damaging Het
Hibadh A G 6: 52,534,880 (GRCm39) S167P probably benign Het
Hsdl1 A G 8: 120,293,072 (GRCm39) V121A probably benign Het
Ift70a1 T C 2: 75,810,688 (GRCm39) H465R probably damaging Het
Ighv1-18 A C 12: 114,646,669 (GRCm39) I6S possibly damaging Het
Iqcm T A 8: 76,281,520 (GRCm39) M1K probably null Het
Itch T C 2: 155,034,079 (GRCm39) F417S probably damaging Het
Itpr1 C T 6: 108,500,366 (GRCm39) T2653I possibly damaging Het
Kank1 T G 19: 25,401,584 (GRCm39) Y1064D probably damaging Het
Kmt2c T C 5: 25,505,561 (GRCm39) Q3249R probably damaging Het
Lefty1 T C 1: 180,765,385 (GRCm39) C318R probably damaging Het
Lmbr1l C T 15: 98,809,500 (GRCm39) V147I probably benign Het
Meig1 C A 2: 3,412,911 (GRCm39) E37* probably null Het
Mpp3 A G 11: 101,899,180 (GRCm39) probably null Het
Muc17 T C 5: 137,175,664 (GRCm39) N2S Het
Mup7 T C 4: 60,067,518 (GRCm39) E199G possibly damaging Het
Nol4 G C 18: 22,852,082 (GRCm39) Y275* probably null Het
Nrxn1 G A 17: 91,008,207 (GRCm39) P429S probably damaging Het
Pfkl A T 10: 77,829,996 (GRCm39) F367L probably damaging Het
Pik3cg T C 12: 32,254,031 (GRCm39) E652G probably benign Het
Prkag3 A G 1: 74,783,980 (GRCm39) I301T probably benign Het
Rcn1 G A 2: 105,224,055 (GRCm39) P163L probably benign Het
Slc1a7 G A 4: 107,869,473 (GRCm39) V513M probably benign Het
Slc37a2 A T 9: 37,150,421 (GRCm39) probably null Het
Slc9b1 C T 3: 135,099,791 (GRCm39) T437I possibly damaging Het
Smap1 T G 1: 23,888,522 (GRCm39) T248P probably benign Het
Smpd3 A C 8: 106,982,254 (GRCm39) C617G probably benign Het
Spata20 T C 11: 94,374,966 (GRCm39) N212S possibly damaging Het
Sphkap A C 1: 83,256,683 (GRCm39) C355W probably damaging Het
Spopfm2 T C 3: 94,082,848 (GRCm39) K321R probably benign Het
Spsb1 T A 4: 149,991,566 (GRCm39) M1L probably damaging Het
Srebf2 C T 15: 82,062,966 (GRCm39) R468C probably damaging Het
Stxbp5 A C 10: 9,646,439 (GRCm39) probably null Het
Taar5 G C 10: 23,847,120 (GRCm39) D173H possibly damaging Het
Tfrc A G 16: 32,440,101 (GRCm39) D438G probably null Het
Tinag A T 9: 76,907,131 (GRCm39) I368K probably benign Het
Tm9sf1 A G 14: 55,873,906 (GRCm39) W531R probably damaging Het
Tnc G T 4: 63,918,961 (GRCm39) P1154Q possibly damaging Het
Toporsl A G 4: 52,611,645 (GRCm39) R513G probably damaging Het
Vat1 A G 11: 101,356,956 (GRCm39) S2P probably benign Het
Vmn2r107 C G 17: 20,577,270 (GRCm39) P423A probably benign Het
Vmn2r2 T A 3: 64,024,808 (GRCm39) E591V probably damaging Het
Vmn2r62 T A 7: 42,437,281 (GRCm39) Y401F probably damaging Het
Vmn2r62 G A 7: 42,414,031 (GRCm39) T804I probably damaging Het
Vmn2r89 A T 14: 51,693,459 (GRCm39) I270F probably damaging Het
Zfp418 T C 7: 7,185,167 (GRCm39) F377L possibly damaging Het
Zkscan5 T C 5: 145,144,502 (GRCm39) S182P unknown Het
Other mutations in Or14j8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01557:Or14j8 APN 17 38,263,742 (GRCm39) missense probably damaging 1.00
IGL02104:Or14j8 APN 17 38,263,182 (GRCm39) missense probably damaging 1.00
IGL02431:Or14j8 APN 17 38,263,413 (GRCm39) missense probably benign 0.06
IGL02649:Or14j8 APN 17 38,263,864 (GRCm39) missense probably damaging 1.00
IGL03109:Or14j8 APN 17 38,263,378 (GRCm39) missense probably damaging 1.00
IGL03261:Or14j8 APN 17 38,263,697 (GRCm39) missense possibly damaging 0.76
R0898:Or14j8 UTSW 17 38,263,127 (GRCm39) missense probably benign 0.17
R1373:Or14j8 UTSW 17 38,263,251 (GRCm39) missense probably damaging 1.00
R1527:Or14j8 UTSW 17 38,263,720 (GRCm39) missense possibly damaging 0.88
R1664:Or14j8 UTSW 17 38,263,784 (GRCm39) missense probably benign 0.44
R1835:Or14j8 UTSW 17 38,263,276 (GRCm39) missense possibly damaging 0.79
R4124:Or14j8 UTSW 17 38,263,681 (GRCm39) missense probably benign 0.16
R4125:Or14j8 UTSW 17 38,263,681 (GRCm39) missense probably benign 0.16
R4128:Or14j8 UTSW 17 38,263,681 (GRCm39) missense probably benign 0.16
R4534:Or14j8 UTSW 17 38,263,613 (GRCm39) missense probably benign
R4557:Or14j8 UTSW 17 38,263,142 (GRCm39) missense probably benign 0.10
R4790:Or14j8 UTSW 17 38,263,633 (GRCm39) missense probably damaging 0.99
R4856:Or14j8 UTSW 17 38,262,962 (GRCm39) missense probably benign 0.15
R4886:Or14j8 UTSW 17 38,262,962 (GRCm39) missense probably benign 0.15
R4955:Or14j8 UTSW 17 38,263,789 (GRCm39) missense probably damaging 1.00
R5162:Or14j8 UTSW 17 38,263,255 (GRCm39) missense probably benign 0.00
R6016:Or14j8 UTSW 17 38,262,967 (GRCm39) missense probably benign 0.13
R6282:Or14j8 UTSW 17 38,263,315 (GRCm39) missense possibly damaging 0.80
R7018:Or14j8 UTSW 17 38,263,393 (GRCm39) missense probably damaging 1.00
R7199:Or14j8 UTSW 17 38,263,048 (GRCm39) missense probably damaging 1.00
R7340:Or14j8 UTSW 17 38,263,413 (GRCm39) missense probably benign 0.06
R7360:Or14j8 UTSW 17 38,263,900 (GRCm39) missense probably damaging 1.00
R7464:Or14j8 UTSW 17 38,263,171 (GRCm39) missense probably damaging 1.00
R8719:Or14j8 UTSW 17 38,263,895 (GRCm39) missense probably damaging 0.97
R8738:Or14j8 UTSW 17 38,263,673 (GRCm39) missense possibly damaging 0.79
R8817:Or14j8 UTSW 17 38,263,273 (GRCm39) missense probably damaging 0.99
R8856:Or14j8 UTSW 17 38,263,091 (GRCm39) missense possibly damaging 0.87
R9006:Or14j8 UTSW 17 38,263,545 (GRCm39) nonsense probably null
R9432:Or14j8 UTSW 17 38,263,559 (GRCm39) missense probably damaging 1.00
X0064:Or14j8 UTSW 17 38,263,705 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGTGCACTTTCTGGGACTC -3'
(R):5'- TGAGTGGATTCCTCCTCGTG -3'

Sequencing Primer
(F):5'- GGGACTCATTATGACCTCATAGTGC -3'
(R):5'- CCATGAGCTGCAGATCTTACAGG -3'
Posted On 2020-09-15