Incidental Mutation 'R7974:AI661453'
ID 650808
Institutional Source Beutler Lab
Gene Symbol AI661453
Ensembl Gene ENSMUSG00000034382
Gene Name expressed sequence AI661453
Synonyms
MMRRC Submission 046017-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.079) question?
Stock # R7974 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 47747564-47781563 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 47777006 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 244 (L244P)
Ref Sequence ENSEMBL: ENSMUSP00000120133 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037701] [ENSMUST00000150819]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000037701
SMART Domains Protein: ENSMUSP00000045345
Gene: ENSMUSG00000034382

DomainStartEndE-ValueType
low complexity region 140 151 N/A INTRINSIC
low complexity region 157 180 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000150819
AA Change: L244P
SMART Domains Protein: ENSMUSP00000120133
Gene: ENSMUSG00000034382
AA Change: L244P

DomainStartEndE-ValueType
low complexity region 140 151 N/A INTRINSIC
low complexity region 157 237 N/A INTRINSIC
low complexity region 294 312 N/A INTRINSIC
low complexity region 314 325 N/A INTRINSIC
low complexity region 354 364 N/A INTRINSIC
low complexity region 384 423 N/A INTRINSIC
low complexity region 429 444 N/A INTRINSIC
low complexity region 522 535 N/A INTRINSIC
low complexity region 612 627 N/A INTRINSIC
internal_repeat_1 628 654 6.24e-9 PROSPERO
low complexity region 656 671 N/A INTRINSIC
internal_repeat_1 688 714 6.24e-9 PROSPERO
low complexity region 853 863 N/A INTRINSIC
low complexity region 976 1016 N/A INTRINSIC
low complexity region 1147 1154 N/A INTRINSIC
Meta Mutation Damage Score 0.0710 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (64/64)
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim1 C T 19: 57,033,405 (GRCm39) probably null Het
Adamts19 A T 18: 59,144,094 (GRCm39) Q892L possibly damaging Het
Adamts9 A G 6: 92,886,668 (GRCm39) probably null Het
Aftph T C 11: 20,648,233 (GRCm39) *686W probably null Het
Ankar C A 1: 72,738,138 (GRCm39) E15* probably null Het
Ankrd39 A G 1: 36,585,999 (GRCm39) probably benign Het
Arsi A G 18: 61,045,478 (GRCm39) D56G probably damaging Het
Blmh T C 11: 76,856,729 (GRCm39) I245T possibly damaging Het
Ccr6 T C 17: 8,475,056 (GRCm39) F87S probably damaging Het
Cdc42ep2 T C 19: 5,968,523 (GRCm39) K61E probably damaging Het
Celsr1 C T 15: 85,915,231 (GRCm39) G914D probably damaging Het
Cep126 T A 9: 8,120,764 (GRCm39) K86N probably benign Het
Cfap70 A T 14: 20,470,818 (GRCm39) F532I probably damaging Het
Cpsf3 T A 12: 21,358,006 (GRCm39) L506Q probably damaging Het
Dct A C 14: 118,277,067 (GRCm39) I273S probably damaging Het
Dsel T C 1: 111,788,229 (GRCm39) I769V probably benign Het
Dus2 G A 8: 106,762,652 (GRCm39) E138K probably benign Het
Emsy A G 7: 98,279,425 (GRCm39) S305P possibly damaging Het
Erp27 A T 6: 136,885,063 (GRCm39) V245D probably damaging Het
Fez1 C A 9: 36,755,244 (GRCm39) T81K probably damaging Het
Gli3 A C 13: 15,900,841 (GRCm39) Q1409H probably benign Het
Hdac9 T C 12: 34,353,219 (GRCm39) S664G possibly damaging Het
Hibadh A G 6: 52,534,880 (GRCm39) S167P probably benign Het
Hsdl1 A G 8: 120,293,072 (GRCm39) V121A probably benign Het
Ift70a1 T C 2: 75,810,688 (GRCm39) H465R probably damaging Het
Ighv1-18 A C 12: 114,646,669 (GRCm39) I6S possibly damaging Het
Iqcm T A 8: 76,281,520 (GRCm39) M1K probably null Het
Itch T C 2: 155,034,079 (GRCm39) F417S probably damaging Het
Itpr1 C T 6: 108,500,366 (GRCm39) T2653I possibly damaging Het
Kank1 T G 19: 25,401,584 (GRCm39) Y1064D probably damaging Het
Kmt2c T C 5: 25,505,561 (GRCm39) Q3249R probably damaging Het
Lefty1 T C 1: 180,765,385 (GRCm39) C318R probably damaging Het
Lmbr1l C T 15: 98,809,500 (GRCm39) V147I probably benign Het
Meig1 C A 2: 3,412,911 (GRCm39) E37* probably null Het
Mpp3 A G 11: 101,899,180 (GRCm39) probably null Het
Muc17 T C 5: 137,175,664 (GRCm39) N2S Het
Mup7 T C 4: 60,067,518 (GRCm39) E199G possibly damaging Het
Nol4 G C 18: 22,852,082 (GRCm39) Y275* probably null Het
Nrxn1 G A 17: 91,008,207 (GRCm39) P429S probably damaging Het
Or14j8 T C 17: 38,263,672 (GRCm39) Y81C probably damaging Het
Pfkl A T 10: 77,829,996 (GRCm39) F367L probably damaging Het
Pik3cg T C 12: 32,254,031 (GRCm39) E652G probably benign Het
Prkag3 A G 1: 74,783,980 (GRCm39) I301T probably benign Het
Rcn1 G A 2: 105,224,055 (GRCm39) P163L probably benign Het
Slc1a7 G A 4: 107,869,473 (GRCm39) V513M probably benign Het
Slc37a2 A T 9: 37,150,421 (GRCm39) probably null Het
Slc9b1 C T 3: 135,099,791 (GRCm39) T437I possibly damaging Het
Smap1 T G 1: 23,888,522 (GRCm39) T248P probably benign Het
Smpd3 A C 8: 106,982,254 (GRCm39) C617G probably benign Het
Spata20 T C 11: 94,374,966 (GRCm39) N212S possibly damaging Het
Sphkap A C 1: 83,256,683 (GRCm39) C355W probably damaging Het
Spopfm2 T C 3: 94,082,848 (GRCm39) K321R probably benign Het
Spsb1 T A 4: 149,991,566 (GRCm39) M1L probably damaging Het
Srebf2 C T 15: 82,062,966 (GRCm39) R468C probably damaging Het
Stxbp5 A C 10: 9,646,439 (GRCm39) probably null Het
Taar5 G C 10: 23,847,120 (GRCm39) D173H possibly damaging Het
Tfrc A G 16: 32,440,101 (GRCm39) D438G probably null Het
Tinag A T 9: 76,907,131 (GRCm39) I368K probably benign Het
Tm9sf1 A G 14: 55,873,906 (GRCm39) W531R probably damaging Het
Tnc G T 4: 63,918,961 (GRCm39) P1154Q possibly damaging Het
Toporsl A G 4: 52,611,645 (GRCm39) R513G probably damaging Het
Vat1 A G 11: 101,356,956 (GRCm39) S2P probably benign Het
Vmn2r107 C G 17: 20,577,270 (GRCm39) P423A probably benign Het
Vmn2r2 T A 3: 64,024,808 (GRCm39) E591V probably damaging Het
Vmn2r62 T A 7: 42,437,281 (GRCm39) Y401F probably damaging Het
Vmn2r62 G A 7: 42,414,031 (GRCm39) T804I probably damaging Het
Vmn2r89 A T 14: 51,693,459 (GRCm39) I270F probably damaging Het
Zfp418 T C 7: 7,185,167 (GRCm39) F377L possibly damaging Het
Zkscan5 T C 5: 145,144,502 (GRCm39) S182P unknown Het
Other mutations in AI661453
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01758:AI661453 APN 17 47,777,548 (GRCm39) intron probably benign
IGL01995:AI661453 APN 17 47,779,442 (GRCm39) intron probably benign
IGL02171:AI661453 APN 17 47,777,921 (GRCm39) intron probably benign
IGL02411:AI661453 APN 17 47,778,263 (GRCm39) intron probably benign
IGL02422:AI661453 APN 17 47,778,017 (GRCm39) intron probably benign
IGL02609:AI661453 APN 17 47,779,297 (GRCm39) intron probably benign
IGL02888:AI661453 APN 17 47,778,329 (GRCm39) intron probably benign
IGL03024:AI661453 APN 17 47,757,513 (GRCm39) missense probably damaging 1.00
R0077:AI661453 UTSW 17 47,780,287 (GRCm39) intron probably benign
R0092:AI661453 UTSW 17 47,778,440 (GRCm39) intron probably benign
R0144:AI661453 UTSW 17 47,780,224 (GRCm39) intron probably benign
R0330:AI661453 UTSW 17 47,757,571 (GRCm39) missense probably damaging 1.00
R0590:AI661453 UTSW 17 47,777,999 (GRCm39) intron probably benign
R0839:AI661453 UTSW 17 47,747,752 (GRCm39) missense probably null 0.97
R1350:AI661453 UTSW 17 47,778,853 (GRCm39) nonsense probably null
R1436:AI661453 UTSW 17 47,777,627 (GRCm39) intron probably benign
R1439:AI661453 UTSW 17 47,777,587 (GRCm39) intron probably benign
R1643:AI661453 UTSW 17 47,778,791 (GRCm39) intron probably benign
R1994:AI661453 UTSW 17 47,777,959 (GRCm39) intron probably benign
R2145:AI661453 UTSW 17 47,777,023 (GRCm39) intron probably benign
R2986:AI661453 UTSW 17 47,777,697 (GRCm39) nonsense probably null
R4398:AI661453 UTSW 17 47,779,042 (GRCm39) intron probably benign
R4809:AI661453 UTSW 17 47,778,112 (GRCm39) intron probably benign
R4913:AI661453 UTSW 17 47,779,480 (GRCm39) nonsense probably null
R4972:AI661453 UTSW 17 47,777,324 (GRCm39) intron probably benign
R6430:AI661453 UTSW 17 47,777,722 (GRCm39) intron probably benign
R6687:AI661453 UTSW 17 47,777,927 (GRCm39) intron probably benign
R7494:AI661453 UTSW 17 47,779,105 (GRCm39) missense unknown
R7598:AI661453 UTSW 17 47,777,045 (GRCm39) missense unknown
R7635:AI661453 UTSW 17 47,778,676 (GRCm39) missense unknown
R7753:AI661453 UTSW 17 47,778,439 (GRCm39) nonsense probably null
R7920:AI661453 UTSW 17 47,779,331 (GRCm39) missense unknown
R8022:AI661453 UTSW 17 47,777,161 (GRCm39) missense unknown
R8489:AI661453 UTSW 17 47,777,254 (GRCm39) intron probably benign
R8771:AI661453 UTSW 17 47,777,683 (GRCm39) missense unknown
R9316:AI661453 UTSW 17 47,747,832 (GRCm39) missense probably benign 0.05
R9596:AI661453 UTSW 17 47,780,411 (GRCm39) missense unknown
R9743:AI661453 UTSW 17 47,780,240 (GRCm39) missense unknown
R9766:AI661453 UTSW 17 47,757,570 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AGGACATTTCACAGCCTCC -3'
(R):5'- ATAGATGAGGTCCTGACTGGG -3'

Sequencing Primer
(F):5'- ACATTTCACAGCCTCCAGGGG -3'
(R):5'- GGTTGGGGGAGGCACCTTC -3'
Posted On 2020-09-15