Incidental Mutation 'R7974:Nol4'
ID 650810
Institutional Source Beutler Lab
Gene Symbol Nol4
Ensembl Gene ENSMUSG00000041923
Gene Name nucleolar protein 4
Synonyms 1700013J13Rik, LOC383304, 4930568N03Rik
MMRRC Submission 046017-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.452) question?
Stock # R7974 (G1)
Quality Score 225.009
Status Validated
Chromosome 18
Chromosomal Location 22826238-23174710 bp(-) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) G to C at 22852082 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Stop codon at position 275 (Y275*)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081423] [ENSMUST00000097651] [ENSMUST00000164186] [ENSMUST00000164893]
AlphaFold P60954
Predicted Effect probably null
Transcript: ENSMUST00000069215
AA Change: Y339*
SMART Domains Protein: ENSMUSP00000064166
Gene: ENSMUSG00000041923
AA Change: Y339*

DomainStartEndE-ValueType
low complexity region 54 65 N/A INTRINSIC
low complexity region 164 175 N/A INTRINSIC
low complexity region 342 361 N/A INTRINSIC
low complexity region 368 378 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000081423
AA Change: Y485*
SMART Domains Protein: ENSMUSP00000080150
Gene: ENSMUSG00000041923
AA Change: Y485*

DomainStartEndE-ValueType
low complexity region 139 155 N/A INTRINSIC
low complexity region 199 210 N/A INTRINSIC
low complexity region 309 320 N/A INTRINSIC
low complexity region 487 506 N/A INTRINSIC
low complexity region 513 523 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000092015
AA Change: Y275*
SMART Domains Protein: ENSMUSP00000089642
Gene: ENSMUSG00000041923
AA Change: Y275*

DomainStartEndE-ValueType
low complexity region 54 65 N/A INTRINSIC
low complexity region 164 175 N/A INTRINSIC
low complexity region 278 297 N/A INTRINSIC
low complexity region 304 314 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000097651
SMART Domains Protein: ENSMUSP00000095256
Gene: ENSMUSG00000041923

DomainStartEndE-ValueType
low complexity region 212 228 N/A INTRINSIC
low complexity region 272 283 N/A INTRINSIC
low complexity region 382 393 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000164186
AA Change: Y558*
SMART Domains Protein: ENSMUSP00000130950
Gene: ENSMUSG00000041923
AA Change: Y558*

DomainStartEndE-ValueType
low complexity region 212 228 N/A INTRINSIC
low complexity region 272 283 N/A INTRINSIC
low complexity region 382 393 N/A INTRINSIC
low complexity region 560 579 N/A INTRINSIC
low complexity region 586 596 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000164893
AA Change: Y494*
SMART Domains Protein: ENSMUSP00000127870
Gene: ENSMUSG00000041923
AA Change: Y494*

DomainStartEndE-ValueType
low complexity region 212 228 N/A INTRINSIC
low complexity region 272 283 N/A INTRINSIC
low complexity region 382 393 N/A INTRINSIC
low complexity region 496 515 N/A INTRINSIC
low complexity region 522 532 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (64/64)
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim1 C T 19: 57,033,405 (GRCm39) probably null Het
Adamts19 A T 18: 59,144,094 (GRCm39) Q892L possibly damaging Het
Adamts9 A G 6: 92,886,668 (GRCm39) probably null Het
Aftph T C 11: 20,648,233 (GRCm39) *686W probably null Het
AI661453 T C 17: 47,777,006 (GRCm39) L244P unknown Het
Ankar C A 1: 72,738,138 (GRCm39) E15* probably null Het
Ankrd39 A G 1: 36,585,999 (GRCm39) probably benign Het
Arsi A G 18: 61,045,478 (GRCm39) D56G probably damaging Het
Blmh T C 11: 76,856,729 (GRCm39) I245T possibly damaging Het
Ccr6 T C 17: 8,475,056 (GRCm39) F87S probably damaging Het
Cdc42ep2 T C 19: 5,968,523 (GRCm39) K61E probably damaging Het
Celsr1 C T 15: 85,915,231 (GRCm39) G914D probably damaging Het
Cep126 T A 9: 8,120,764 (GRCm39) K86N probably benign Het
Cfap70 A T 14: 20,470,818 (GRCm39) F532I probably damaging Het
Cpsf3 T A 12: 21,358,006 (GRCm39) L506Q probably damaging Het
Dct A C 14: 118,277,067 (GRCm39) I273S probably damaging Het
Dsel T C 1: 111,788,229 (GRCm39) I769V probably benign Het
Dus2 G A 8: 106,762,652 (GRCm39) E138K probably benign Het
Emsy A G 7: 98,279,425 (GRCm39) S305P possibly damaging Het
Erp27 A T 6: 136,885,063 (GRCm39) V245D probably damaging Het
Fez1 C A 9: 36,755,244 (GRCm39) T81K probably damaging Het
Gli3 A C 13: 15,900,841 (GRCm39) Q1409H probably benign Het
Hdac9 T C 12: 34,353,219 (GRCm39) S664G possibly damaging Het
Hibadh A G 6: 52,534,880 (GRCm39) S167P probably benign Het
Hsdl1 A G 8: 120,293,072 (GRCm39) V121A probably benign Het
Ift70a1 T C 2: 75,810,688 (GRCm39) H465R probably damaging Het
Ighv1-18 A C 12: 114,646,669 (GRCm39) I6S possibly damaging Het
Iqcm T A 8: 76,281,520 (GRCm39) M1K probably null Het
Itch T C 2: 155,034,079 (GRCm39) F417S probably damaging Het
Itpr1 C T 6: 108,500,366 (GRCm39) T2653I possibly damaging Het
Kank1 T G 19: 25,401,584 (GRCm39) Y1064D probably damaging Het
Kmt2c T C 5: 25,505,561 (GRCm39) Q3249R probably damaging Het
Lefty1 T C 1: 180,765,385 (GRCm39) C318R probably damaging Het
Lmbr1l C T 15: 98,809,500 (GRCm39) V147I probably benign Het
Meig1 C A 2: 3,412,911 (GRCm39) E37* probably null Het
Mpp3 A G 11: 101,899,180 (GRCm39) probably null Het
Muc17 T C 5: 137,175,664 (GRCm39) N2S Het
Mup7 T C 4: 60,067,518 (GRCm39) E199G possibly damaging Het
Nrxn1 G A 17: 91,008,207 (GRCm39) P429S probably damaging Het
Or14j8 T C 17: 38,263,672 (GRCm39) Y81C probably damaging Het
Pfkl A T 10: 77,829,996 (GRCm39) F367L probably damaging Het
Pik3cg T C 12: 32,254,031 (GRCm39) E652G probably benign Het
Prkag3 A G 1: 74,783,980 (GRCm39) I301T probably benign Het
Rcn1 G A 2: 105,224,055 (GRCm39) P163L probably benign Het
Slc1a7 G A 4: 107,869,473 (GRCm39) V513M probably benign Het
Slc37a2 A T 9: 37,150,421 (GRCm39) probably null Het
Slc9b1 C T 3: 135,099,791 (GRCm39) T437I possibly damaging Het
Smap1 T G 1: 23,888,522 (GRCm39) T248P probably benign Het
Smpd3 A C 8: 106,982,254 (GRCm39) C617G probably benign Het
Spata20 T C 11: 94,374,966 (GRCm39) N212S possibly damaging Het
Sphkap A C 1: 83,256,683 (GRCm39) C355W probably damaging Het
Spopfm2 T C 3: 94,082,848 (GRCm39) K321R probably benign Het
Spsb1 T A 4: 149,991,566 (GRCm39) M1L probably damaging Het
Srebf2 C T 15: 82,062,966 (GRCm39) R468C probably damaging Het
Stxbp5 A C 10: 9,646,439 (GRCm39) probably null Het
Taar5 G C 10: 23,847,120 (GRCm39) D173H possibly damaging Het
Tfrc A G 16: 32,440,101 (GRCm39) D438G probably null Het
Tinag A T 9: 76,907,131 (GRCm39) I368K probably benign Het
Tm9sf1 A G 14: 55,873,906 (GRCm39) W531R probably damaging Het
Tnc G T 4: 63,918,961 (GRCm39) P1154Q possibly damaging Het
Toporsl A G 4: 52,611,645 (GRCm39) R513G probably damaging Het
Vat1 A G 11: 101,356,956 (GRCm39) S2P probably benign Het
Vmn2r107 C G 17: 20,577,270 (GRCm39) P423A probably benign Het
Vmn2r2 T A 3: 64,024,808 (GRCm39) E591V probably damaging Het
Vmn2r62 T A 7: 42,437,281 (GRCm39) Y401F probably damaging Het
Vmn2r62 G A 7: 42,414,031 (GRCm39) T804I probably damaging Het
Vmn2r89 A T 14: 51,693,459 (GRCm39) I270F probably damaging Het
Zfp418 T C 7: 7,185,167 (GRCm39) F377L possibly damaging Het
Zkscan5 T C 5: 145,144,502 (GRCm39) S182P unknown Het
Other mutations in Nol4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00339:Nol4 APN 18 22,956,469 (GRCm39) missense probably benign 0.15
IGL00677:Nol4 APN 18 23,054,924 (GRCm39) missense probably damaging 1.00
IGL01153:Nol4 APN 18 22,902,850 (GRCm39) missense probably damaging 1.00
IGL01400:Nol4 APN 18 22,956,555 (GRCm39) missense probably damaging 0.99
IGL02006:Nol4 APN 18 23,054,975 (GRCm39) missense probably damaging 1.00
IGL02342:Nol4 APN 18 22,903,926 (GRCm39) splice site probably benign
IGL02501:Nol4 APN 18 22,956,398 (GRCm39) missense probably damaging 1.00
PIT4378001:Nol4 UTSW 18 23,172,933 (GRCm39) missense probably damaging 1.00
R0096:Nol4 UTSW 18 23,054,915 (GRCm39) missense possibly damaging 0.95
R0097:Nol4 UTSW 18 22,852,198 (GRCm39) missense probably benign 0.23
R0097:Nol4 UTSW 18 22,852,198 (GRCm39) missense probably benign 0.23
R1257:Nol4 UTSW 18 22,903,738 (GRCm39) missense probably damaging 1.00
R1793:Nol4 UTSW 18 22,902,878 (GRCm39) missense probably damaging 1.00
R2101:Nol4 UTSW 18 22,956,466 (GRCm39) missense probably damaging 1.00
R2357:Nol4 UTSW 18 23,172,967 (GRCm39) missense probably benign 0.01
R2414:Nol4 UTSW 18 22,956,629 (GRCm39) critical splice acceptor site probably null
R2427:Nol4 UTSW 18 22,983,755 (GRCm39) intron probably benign
R3713:Nol4 UTSW 18 23,172,994 (GRCm39) missense probably damaging 1.00
R3734:Nol4 UTSW 18 22,903,921 (GRCm39) splice site probably benign
R3803:Nol4 UTSW 18 22,828,012 (GRCm39) missense probably damaging 1.00
R4458:Nol4 UTSW 18 22,885,052 (GRCm39) missense probably damaging 0.99
R4736:Nol4 UTSW 18 22,852,050 (GRCm39) missense probably damaging 1.00
R4774:Nol4 UTSW 18 23,045,683 (GRCm39) missense probably damaging 0.96
R4795:Nol4 UTSW 18 23,054,944 (GRCm39) missense probably damaging 1.00
R5245:Nol4 UTSW 18 22,828,179 (GRCm39) makesense probably null
R5980:Nol4 UTSW 18 23,085,258 (GRCm39) missense probably damaging 0.97
R6372:Nol4 UTSW 18 23,171,613 (GRCm39) critical splice donor site probably null
R6485:Nol4 UTSW 18 22,903,850 (GRCm39) missense probably damaging 1.00
R6614:Nol4 UTSW 18 23,053,913 (GRCm39) missense probably damaging 1.00
R6809:Nol4 UTSW 18 23,053,882 (GRCm39) missense probably damaging 1.00
R6877:Nol4 UTSW 18 22,852,186 (GRCm39) missense probably benign 0.06
R7269:Nol4 UTSW 18 23,172,846 (GRCm39) missense probably benign
R7310:Nol4 UTSW 18 22,903,801 (GRCm39) missense
R7720:Nol4 UTSW 18 23,173,080 (GRCm39) missense probably benign 0.16
R7753:Nol4 UTSW 18 23,171,659 (GRCm39) start codon destroyed probably benign 0.15
R7897:Nol4 UTSW 18 22,956,400 (GRCm39) missense
R8297:Nol4 UTSW 18 23,173,069 (GRCm39) missense probably damaging 0.99
R8303:Nol4 UTSW 18 23,173,231 (GRCm39) unclassified probably benign
R8466:Nol4 UTSW 18 23,171,638 (GRCm39) missense probably benign 0.03
R8985:Nol4 UTSW 18 23,085,294 (GRCm39) missense probably damaging 1.00
R9064:Nol4 UTSW 18 22,903,850 (GRCm39) missense
R9296:Nol4 UTSW 18 22,956,388 (GRCm39) missense
R9442:Nol4 UTSW 18 22,902,899 (GRCm39) missense probably damaging 1.00
R9456:Nol4 UTSW 18 23,172,897 (GRCm39) missense probably benign 0.41
R9469:Nol4 UTSW 18 23,085,318 (GRCm39) missense probably damaging 0.99
R9478:Nol4 UTSW 18 23,053,934 (GRCm39) missense probably damaging 1.00
R9708:Nol4 UTSW 18 22,828,053 (GRCm39) missense probably damaging 1.00
Z1088:Nol4 UTSW 18 23,054,959 (GRCm39) missense probably damaging 1.00
Z1177:Nol4 UTSW 18 22,902,897 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- AACAGAGTGAGCTACCCAGG -3'
(R):5'- CTGGCATTGAGAGTGTACAGAG -3'

Sequencing Primer
(F):5'- CATTGTGTTTTCAAATAGCCTCG -3'
(R):5'- GAGAAGCAGTGCAAAAATGTCAC -3'
Posted On 2020-09-15