Incidental Mutation 'R7974:Adamts19'
ID 650811
Institutional Source Beutler Lab
Gene Symbol Adamts19
Ensembl Gene ENSMUSG00000053441
Gene Name ADAM metallopeptidase with thrombospondin type 1 motif 19
Synonyms D230034E10Rik
MMRRC Submission 046017-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7974 (G1)
Quality Score 225.009
Status Validated
Chromosome 18
Chromosomal Location 58969739-59187132 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 59144094 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Leucine at position 892 (Q892L)
Ref Sequence ENSEMBL: ENSMUSP00000050535 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052907]
AlphaFold P59509
Predicted Effect possibly damaging
Transcript: ENSMUST00000052907
AA Change: Q892L

PolyPhen 2 Score 0.721 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000050535
Gene: ENSMUSG00000053441
AA Change: Q892L

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
low complexity region 57 84 N/A INTRINSIC
low complexity region 109 124 N/A INTRINSIC
Pfam:Pep_M12B_propep 131 276 1.6e-21 PFAM
Pfam:Reprolysin_5 326 523 1.7e-13 PFAM
Pfam:Reprolysin_4 328 544 2e-10 PFAM
Pfam:Reprolysin 328 548 9e-22 PFAM
Pfam:Reprolysin_2 346 537 1.6e-9 PFAM
Pfam:Reprolysin_3 350 496 3.4e-12 PFAM
low complexity region 551 562 N/A INTRINSIC
TSP1 639 689 5.68e-9 SMART
Pfam:ADAM_spacer1 793 903 1.1e-31 PFAM
TSP1 922 980 4.95e-2 SMART
TSP1 982 1040 4.95e-2 SMART
TSP1 1042 1086 1.62e-4 SMART
TSP1 1093 1147 1.03e-6 SMART
Pfam:PLAC 1167 1199 4.2e-9 PFAM
Meta Mutation Damage Score 0.1139 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (64/64)
MGI Phenotype FUNCTION: This gene encodes a member of "a disintegrin and metalloproteinase with thrombospondin motifs" (ADAMTS) family of multi-domain matrix-associated metalloendopeptidases that have diverse roles in tissue morphogenesis and pathophysiological remodeling, in inflammation and in vascular biology. This gene is predominantly expressed in the ovary with lower levels of expression observed in kidney, heart, skeletal muscle, lung and testis. The encoded preproprotein undergoes proteolytic processing to generate an active protease. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim1 C T 19: 57,033,405 (GRCm39) probably null Het
Adamts9 A G 6: 92,886,668 (GRCm39) probably null Het
Aftph T C 11: 20,648,233 (GRCm39) *686W probably null Het
AI661453 T C 17: 47,777,006 (GRCm39) L244P unknown Het
Ankar C A 1: 72,738,138 (GRCm39) E15* probably null Het
Ankrd39 A G 1: 36,585,999 (GRCm39) probably benign Het
Arsi A G 18: 61,045,478 (GRCm39) D56G probably damaging Het
Blmh T C 11: 76,856,729 (GRCm39) I245T possibly damaging Het
Ccr6 T C 17: 8,475,056 (GRCm39) F87S probably damaging Het
Cdc42ep2 T C 19: 5,968,523 (GRCm39) K61E probably damaging Het
Celsr1 C T 15: 85,915,231 (GRCm39) G914D probably damaging Het
Cep126 T A 9: 8,120,764 (GRCm39) K86N probably benign Het
Cfap70 A T 14: 20,470,818 (GRCm39) F532I probably damaging Het
Cpsf3 T A 12: 21,358,006 (GRCm39) L506Q probably damaging Het
Dct A C 14: 118,277,067 (GRCm39) I273S probably damaging Het
Dsel T C 1: 111,788,229 (GRCm39) I769V probably benign Het
Dus2 G A 8: 106,762,652 (GRCm39) E138K probably benign Het
Emsy A G 7: 98,279,425 (GRCm39) S305P possibly damaging Het
Erp27 A T 6: 136,885,063 (GRCm39) V245D probably damaging Het
Fez1 C A 9: 36,755,244 (GRCm39) T81K probably damaging Het
Gli3 A C 13: 15,900,841 (GRCm39) Q1409H probably benign Het
Hdac9 T C 12: 34,353,219 (GRCm39) S664G possibly damaging Het
Hibadh A G 6: 52,534,880 (GRCm39) S167P probably benign Het
Hsdl1 A G 8: 120,293,072 (GRCm39) V121A probably benign Het
Ift70a1 T C 2: 75,810,688 (GRCm39) H465R probably damaging Het
Ighv1-18 A C 12: 114,646,669 (GRCm39) I6S possibly damaging Het
Iqcm T A 8: 76,281,520 (GRCm39) M1K probably null Het
Itch T C 2: 155,034,079 (GRCm39) F417S probably damaging Het
Itpr1 C T 6: 108,500,366 (GRCm39) T2653I possibly damaging Het
Kank1 T G 19: 25,401,584 (GRCm39) Y1064D probably damaging Het
Kmt2c T C 5: 25,505,561 (GRCm39) Q3249R probably damaging Het
Lefty1 T C 1: 180,765,385 (GRCm39) C318R probably damaging Het
Lmbr1l C T 15: 98,809,500 (GRCm39) V147I probably benign Het
Meig1 C A 2: 3,412,911 (GRCm39) E37* probably null Het
Mpp3 A G 11: 101,899,180 (GRCm39) probably null Het
Muc17 T C 5: 137,175,664 (GRCm39) N2S Het
Mup7 T C 4: 60,067,518 (GRCm39) E199G possibly damaging Het
Nol4 G C 18: 22,852,082 (GRCm39) Y275* probably null Het
Nrxn1 G A 17: 91,008,207 (GRCm39) P429S probably damaging Het
Or14j8 T C 17: 38,263,672 (GRCm39) Y81C probably damaging Het
Pfkl A T 10: 77,829,996 (GRCm39) F367L probably damaging Het
Pik3cg T C 12: 32,254,031 (GRCm39) E652G probably benign Het
Prkag3 A G 1: 74,783,980 (GRCm39) I301T probably benign Het
Rcn1 G A 2: 105,224,055 (GRCm39) P163L probably benign Het
Slc1a7 G A 4: 107,869,473 (GRCm39) V513M probably benign Het
Slc37a2 A T 9: 37,150,421 (GRCm39) probably null Het
Slc9b1 C T 3: 135,099,791 (GRCm39) T437I possibly damaging Het
Smap1 T G 1: 23,888,522 (GRCm39) T248P probably benign Het
Smpd3 A C 8: 106,982,254 (GRCm39) C617G probably benign Het
Spata20 T C 11: 94,374,966 (GRCm39) N212S possibly damaging Het
Sphkap A C 1: 83,256,683 (GRCm39) C355W probably damaging Het
Spopfm2 T C 3: 94,082,848 (GRCm39) K321R probably benign Het
Spsb1 T A 4: 149,991,566 (GRCm39) M1L probably damaging Het
Srebf2 C T 15: 82,062,966 (GRCm39) R468C probably damaging Het
Stxbp5 A C 10: 9,646,439 (GRCm39) probably null Het
Taar5 G C 10: 23,847,120 (GRCm39) D173H possibly damaging Het
Tfrc A G 16: 32,440,101 (GRCm39) D438G probably null Het
Tinag A T 9: 76,907,131 (GRCm39) I368K probably benign Het
Tm9sf1 A G 14: 55,873,906 (GRCm39) W531R probably damaging Het
Tnc G T 4: 63,918,961 (GRCm39) P1154Q possibly damaging Het
Toporsl A G 4: 52,611,645 (GRCm39) R513G probably damaging Het
Vat1 A G 11: 101,356,956 (GRCm39) S2P probably benign Het
Vmn2r107 C G 17: 20,577,270 (GRCm39) P423A probably benign Het
Vmn2r2 T A 3: 64,024,808 (GRCm39) E591V probably damaging Het
Vmn2r62 T A 7: 42,437,281 (GRCm39) Y401F probably damaging Het
Vmn2r62 G A 7: 42,414,031 (GRCm39) T804I probably damaging Het
Vmn2r89 A T 14: 51,693,459 (GRCm39) I270F probably damaging Het
Zfp418 T C 7: 7,185,167 (GRCm39) F377L possibly damaging Het
Zkscan5 T C 5: 145,144,502 (GRCm39) S182P unknown Het
Other mutations in Adamts19
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00156:Adamts19 APN 18 59,157,537 (GRCm39) missense probably damaging 1.00
IGL00331:Adamts19 APN 18 59,140,397 (GRCm39) splice site probably benign
IGL00970:Adamts19 APN 18 59,144,149 (GRCm39) missense possibly damaging 0.82
IGL01328:Adamts19 APN 18 59,181,954 (GRCm39) missense possibly damaging 0.89
IGL01385:Adamts19 APN 18 59,105,851 (GRCm39) missense probably damaging 0.98
IGL01529:Adamts19 APN 18 59,096,535 (GRCm39) missense probably damaging 0.99
IGL01535:Adamts19 APN 18 59,101,891 (GRCm39) missense probably benign 0.00
IGL01557:Adamts19 APN 18 59,101,792 (GRCm39) splice site probably null
IGL01705:Adamts19 APN 18 59,166,038 (GRCm39) missense possibly damaging 0.91
IGL01803:Adamts19 APN 18 59,085,541 (GRCm39) missense probably damaging 1.00
IGL02116:Adamts19 APN 18 58,970,571 (GRCm39) missense probably benign
IGL02131:Adamts19 APN 18 59,185,732 (GRCm39) missense probably damaging 1.00
IGL02312:Adamts19 APN 18 59,060,369 (GRCm39) missense probably damaging 1.00
IGL02755:Adamts19 APN 18 59,103,005 (GRCm39) missense probably benign 0.25
IGL02866:Adamts19 APN 18 59,181,914 (GRCm39) missense possibly damaging 0.80
IGL02964:Adamts19 APN 18 59,122,037 (GRCm39) missense probably damaging 1.00
IGL02982:Adamts19 APN 18 59,157,590 (GRCm39) missense probably damaging 1.00
IGL03040:Adamts19 APN 18 59,036,080 (GRCm39) missense probably benign 0.05
R0081:Adamts19 UTSW 18 59,036,137 (GRCm39) critical splice donor site probably null
R0194:Adamts19 UTSW 18 59,144,220 (GRCm39) missense probably null 1.00
R0195:Adamts19 UTSW 18 59,102,942 (GRCm39) splice site probably benign
R0541:Adamts19 UTSW 18 59,060,372 (GRCm39) critical splice donor site probably null
R0659:Adamts19 UTSW 18 59,140,565 (GRCm39) splice site probably benign
R0967:Adamts19 UTSW 18 59,105,812 (GRCm39) nonsense probably null
R1512:Adamts19 UTSW 18 59,181,917 (GRCm39) missense possibly damaging 0.89
R1536:Adamts19 UTSW 18 59,185,687 (GRCm39) missense probably damaging 1.00
R1582:Adamts19 UTSW 18 59,103,013 (GRCm39) missense probably damaging 0.98
R1629:Adamts19 UTSW 18 59,087,691 (GRCm39) missense probably damaging 0.97
R1653:Adamts19 UTSW 18 59,023,365 (GRCm39) missense probably benign 0.00
R1718:Adamts19 UTSW 18 59,105,897 (GRCm39) missense probably damaging 1.00
R1733:Adamts19 UTSW 18 59,165,001 (GRCm39) missense probably damaging 1.00
R1753:Adamts19 UTSW 18 59,140,444 (GRCm39) missense possibly damaging 0.78
R1776:Adamts19 UTSW 18 59,087,692 (GRCm39) missense probably damaging 1.00
R1905:Adamts19 UTSW 18 59,166,017 (GRCm39) missense possibly damaging 0.92
R1958:Adamts19 UTSW 18 59,103,078 (GRCm39) missense probably benign 0.09
R1994:Adamts19 UTSW 18 59,105,903 (GRCm39) critical splice donor site probably null
R2177:Adamts19 UTSW 18 59,087,626 (GRCm39) missense possibly damaging 0.66
R3730:Adamts19 UTSW 18 59,033,982 (GRCm39) missense probably damaging 1.00
R4342:Adamts19 UTSW 18 59,075,572 (GRCm39) missense probably damaging 1.00
R4772:Adamts19 UTSW 18 58,970,848 (GRCm39) missense possibly damaging 0.85
R4822:Adamts19 UTSW 18 59,023,356 (GRCm39) missense probably damaging 1.00
R4891:Adamts19 UTSW 18 59,166,072 (GRCm39) missense probably damaging 1.00
R5112:Adamts19 UTSW 18 59,164,876 (GRCm39) nonsense probably null
R5116:Adamts19 UTSW 18 59,036,066 (GRCm39) missense possibly damaging 0.52
R5205:Adamts19 UTSW 18 59,101,880 (GRCm39) missense probably damaging 1.00
R5765:Adamts19 UTSW 18 59,185,654 (GRCm39) missense probably damaging 1.00
R5781:Adamts19 UTSW 18 58,971,040 (GRCm39) missense possibly damaging 0.59
R5792:Adamts19 UTSW 18 58,970,584 (GRCm39) missense possibly damaging 0.49
R6082:Adamts19 UTSW 18 59,101,846 (GRCm39) missense probably benign 0.18
R6088:Adamts19 UTSW 18 59,035,174 (GRCm39) missense probably damaging 1.00
R7060:Adamts19 UTSW 18 58,970,712 (GRCm39) nonsense probably null
R7251:Adamts19 UTSW 18 58,970,974 (GRCm39) missense probably damaging 1.00
R7295:Adamts19 UTSW 18 58,970,955 (GRCm39) missense probably damaging 1.00
R7991:Adamts19 UTSW 18 59,185,726 (GRCm39) missense probably damaging 1.00
R8129:Adamts19 UTSW 18 59,140,559 (GRCm39) critical splice donor site probably null
R8297:Adamts19 UTSW 18 58,970,920 (GRCm39) missense probably damaging 1.00
R8336:Adamts19 UTSW 18 59,140,444 (GRCm39) missense possibly damaging 0.78
R8358:Adamts19 UTSW 18 59,181,881 (GRCm39) missense probably damaging 1.00
R8864:Adamts19 UTSW 18 59,023,497 (GRCm39) nonsense probably null
R9051:Adamts19 UTSW 18 59,034,048 (GRCm39) missense probably damaging 1.00
R9253:Adamts19 UTSW 18 59,103,013 (GRCm39) missense probably damaging 0.98
R9423:Adamts19 UTSW 18 59,023,427 (GRCm39) missense possibly damaging 0.89
R9610:Adamts19 UTSW 18 59,023,399 (GRCm39) missense probably benign 0.26
R9611:Adamts19 UTSW 18 59,023,399 (GRCm39) missense probably benign 0.26
R9686:Adamts19 UTSW 18 58,971,093 (GRCm39) missense probably benign 0.00
R9697:Adamts19 UTSW 18 59,101,834 (GRCm39) missense probably damaging 0.99
R9747:Adamts19 UTSW 18 59,023,487 (GRCm39) missense possibly damaging 0.69
Z1177:Adamts19 UTSW 18 59,023,446 (GRCm39) missense possibly damaging 0.47
Z1177:Adamts19 UTSW 18 58,971,147 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGGCTCACAGGTGATTCTC -3'
(R):5'- GTACACACATTCTAAGGAACGTAG -3'

Sequencing Primer
(F):5'- ATGGCTCACAGGTGATTCTCCTATC -3'
(R):5'- CGTGTGTCCACATGAAG -3'
Posted On 2020-09-15