Incidental Mutation 'R7974:Kank1'
ID 650814
Institutional Source Beutler Lab
Gene Symbol Kank1
Ensembl Gene ENSMUSG00000032702
Gene Name KN motif and ankyrin repeat domains 1
Synonyms Ankrd15, D330024H06Rik, A930031B09Rik
MMRRC Submission 046017-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7974 (G1)
Quality Score 225.009
Status Validated
Chromosome 19
Chromosomal Location 25214339-25411860 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 25401584 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Aspartic acid at position 1064 (Y1064D)
Ref Sequence ENSEMBL: ENSMUSP00000116660 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049400] [ENSMUST00000146647]
AlphaFold E9Q238
Predicted Effect probably benign
Transcript: ENSMUST00000049400
AA Change: Y1036D

PolyPhen 2 Score 0.369 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000042177
Gene: ENSMUSG00000032702
AA Change: Y1036D

DomainStartEndE-ValueType
Pfam:KN_motif 30 68 3.3e-24 PFAM
low complexity region 88 105 N/A INTRINSIC
low complexity region 138 148 N/A INTRINSIC
coiled coil region 286 314 N/A INTRINSIC
low complexity region 350 358 N/A INTRINSIC
coiled coil region 362 395 N/A INTRINSIC
coiled coil region 451 494 N/A INTRINSIC
low complexity region 541 556 N/A INTRINSIC
low complexity region 617 629 N/A INTRINSIC
Blast:ANK 963 993 7e-10 BLAST
low complexity region 1010 1030 N/A INTRINSIC
low complexity region 1074 1095 N/A INTRINSIC
ANK 1169 1199 3.71e-4 SMART
ANK 1203 1236 2.27e1 SMART
ANK 1241 1270 1.33e-5 SMART
ANK 1274 1306 5.84e-2 SMART
ANK 1308 1336 4.86e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000146647
AA Change: Y1064D

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000116660
Gene: ENSMUSG00000032702
AA Change: Y1064D

DomainStartEndE-ValueType
Pfam:KN_motif 58 96 2e-25 PFAM
low complexity region 116 133 N/A INTRINSIC
low complexity region 166 176 N/A INTRINSIC
coiled coil region 314 342 N/A INTRINSIC
low complexity region 378 386 N/A INTRINSIC
coiled coil region 390 423 N/A INTRINSIC
internal_repeat_1 430 479 3.72e-5 PROSPERO
low complexity region 569 584 N/A INTRINSIC
internal_repeat_1 587 636 3.72e-5 PROSPERO
low complexity region 645 657 N/A INTRINSIC
Blast:ANK 991 1021 4e-10 BLAST
low complexity region 1038 1058 N/A INTRINSIC
low complexity region 1102 1123 N/A INTRINSIC
Meta Mutation Damage Score 0.0872 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (64/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the Kank family of proteins, which contain multiple ankyrin repeat domains. This family member functions in cytoskeleton formation by regulating actin polymerization. This gene is a candidate tumor suppressor for renal cell carcinoma. Mutations in this gene cause cerebral palsy spastic quadriplegic type 2, a central nervous system development disorder. A t(5;9) translocation results in fusion of the platelet-derived growth factor receptor beta gene (PDGFRB) on chromosome 5 with this gene in a myeloproliferative neoplasm featuring severe thrombocythemia. Alternative splicing of this gene results in multiple transcript variants. A related pseudogene has been identified on chromosome 20. [provided by RefSeq, Dec 2014]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim1 C T 19: 57,033,405 (GRCm39) probably null Het
Adamts19 A T 18: 59,144,094 (GRCm39) Q892L possibly damaging Het
Adamts9 A G 6: 92,886,668 (GRCm39) probably null Het
Aftph T C 11: 20,648,233 (GRCm39) *686W probably null Het
AI661453 T C 17: 47,777,006 (GRCm39) L244P unknown Het
Ankar C A 1: 72,738,138 (GRCm39) E15* probably null Het
Ankrd39 A G 1: 36,585,999 (GRCm39) probably benign Het
Arsi A G 18: 61,045,478 (GRCm39) D56G probably damaging Het
Blmh T C 11: 76,856,729 (GRCm39) I245T possibly damaging Het
Ccr6 T C 17: 8,475,056 (GRCm39) F87S probably damaging Het
Cdc42ep2 T C 19: 5,968,523 (GRCm39) K61E probably damaging Het
Celsr1 C T 15: 85,915,231 (GRCm39) G914D probably damaging Het
Cep126 T A 9: 8,120,764 (GRCm39) K86N probably benign Het
Cfap70 A T 14: 20,470,818 (GRCm39) F532I probably damaging Het
Cpsf3 T A 12: 21,358,006 (GRCm39) L506Q probably damaging Het
Dct A C 14: 118,277,067 (GRCm39) I273S probably damaging Het
Dsel T C 1: 111,788,229 (GRCm39) I769V probably benign Het
Dus2 G A 8: 106,762,652 (GRCm39) E138K probably benign Het
Emsy A G 7: 98,279,425 (GRCm39) S305P possibly damaging Het
Erp27 A T 6: 136,885,063 (GRCm39) V245D probably damaging Het
Fez1 C A 9: 36,755,244 (GRCm39) T81K probably damaging Het
Gli3 A C 13: 15,900,841 (GRCm39) Q1409H probably benign Het
Hdac9 T C 12: 34,353,219 (GRCm39) S664G possibly damaging Het
Hibadh A G 6: 52,534,880 (GRCm39) S167P probably benign Het
Hsdl1 A G 8: 120,293,072 (GRCm39) V121A probably benign Het
Ift70a1 T C 2: 75,810,688 (GRCm39) H465R probably damaging Het
Ighv1-18 A C 12: 114,646,669 (GRCm39) I6S possibly damaging Het
Iqcm T A 8: 76,281,520 (GRCm39) M1K probably null Het
Itch T C 2: 155,034,079 (GRCm39) F417S probably damaging Het
Itpr1 C T 6: 108,500,366 (GRCm39) T2653I possibly damaging Het
Kmt2c T C 5: 25,505,561 (GRCm39) Q3249R probably damaging Het
Lefty1 T C 1: 180,765,385 (GRCm39) C318R probably damaging Het
Lmbr1l C T 15: 98,809,500 (GRCm39) V147I probably benign Het
Meig1 C A 2: 3,412,911 (GRCm39) E37* probably null Het
Mpp3 A G 11: 101,899,180 (GRCm39) probably null Het
Muc17 T C 5: 137,175,664 (GRCm39) N2S Het
Mup7 T C 4: 60,067,518 (GRCm39) E199G possibly damaging Het
Nol4 G C 18: 22,852,082 (GRCm39) Y275* probably null Het
Nrxn1 G A 17: 91,008,207 (GRCm39) P429S probably damaging Het
Or14j8 T C 17: 38,263,672 (GRCm39) Y81C probably damaging Het
Pfkl A T 10: 77,829,996 (GRCm39) F367L probably damaging Het
Pik3cg T C 12: 32,254,031 (GRCm39) E652G probably benign Het
Prkag3 A G 1: 74,783,980 (GRCm39) I301T probably benign Het
Rcn1 G A 2: 105,224,055 (GRCm39) P163L probably benign Het
Slc1a7 G A 4: 107,869,473 (GRCm39) V513M probably benign Het
Slc37a2 A T 9: 37,150,421 (GRCm39) probably null Het
Slc9b1 C T 3: 135,099,791 (GRCm39) T437I possibly damaging Het
Smap1 T G 1: 23,888,522 (GRCm39) T248P probably benign Het
Smpd3 A C 8: 106,982,254 (GRCm39) C617G probably benign Het
Spata20 T C 11: 94,374,966 (GRCm39) N212S possibly damaging Het
Sphkap A C 1: 83,256,683 (GRCm39) C355W probably damaging Het
Spopfm2 T C 3: 94,082,848 (GRCm39) K321R probably benign Het
Spsb1 T A 4: 149,991,566 (GRCm39) M1L probably damaging Het
Srebf2 C T 15: 82,062,966 (GRCm39) R468C probably damaging Het
Stxbp5 A C 10: 9,646,439 (GRCm39) probably null Het
Taar5 G C 10: 23,847,120 (GRCm39) D173H possibly damaging Het
Tfrc A G 16: 32,440,101 (GRCm39) D438G probably null Het
Tinag A T 9: 76,907,131 (GRCm39) I368K probably benign Het
Tm9sf1 A G 14: 55,873,906 (GRCm39) W531R probably damaging Het
Tnc G T 4: 63,918,961 (GRCm39) P1154Q possibly damaging Het
Toporsl A G 4: 52,611,645 (GRCm39) R513G probably damaging Het
Vat1 A G 11: 101,356,956 (GRCm39) S2P probably benign Het
Vmn2r107 C G 17: 20,577,270 (GRCm39) P423A probably benign Het
Vmn2r2 T A 3: 64,024,808 (GRCm39) E591V probably damaging Het
Vmn2r62 T A 7: 42,437,281 (GRCm39) Y401F probably damaging Het
Vmn2r62 G A 7: 42,414,031 (GRCm39) T804I probably damaging Het
Vmn2r89 A T 14: 51,693,459 (GRCm39) I270F probably damaging Het
Zfp418 T C 7: 7,185,167 (GRCm39) F377L possibly damaging Het
Zkscan5 T C 5: 145,144,502 (GRCm39) S182P unknown Het
Other mutations in Kank1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00324:Kank1 APN 19 25,389,122 (GRCm39) missense probably benign
IGL00435:Kank1 APN 19 25,407,600 (GRCm39) missense probably benign 0.41
IGL01105:Kank1 APN 19 25,401,680 (GRCm39) missense possibly damaging 0.80
IGL01974:Kank1 APN 19 25,387,596 (GRCm39) missense possibly damaging 0.87
IGL02031:Kank1 APN 19 25,388,066 (GRCm39) missense probably benign 0.01
IGL02125:Kank1 APN 19 25,388,067 (GRCm39) missense possibly damaging 0.90
IGL02152:Kank1 APN 19 25,405,536 (GRCm39) missense possibly damaging 0.51
IGL02211:Kank1 APN 19 25,407,702 (GRCm39) missense probably damaging 1.00
IGL02440:Kank1 APN 19 25,410,272 (GRCm39) missense probably damaging 1.00
IGL02448:Kank1 APN 19 25,388,739 (GRCm39) missense probably damaging 1.00
IGL02671:Kank1 APN 19 25,405,459 (GRCm39) missense probably damaging 1.00
IGL03102:Kank1 APN 19 25,403,282 (GRCm39) missense probably damaging 1.00
IGL03259:Kank1 APN 19 25,407,705 (GRCm39) missense probably damaging 1.00
IGL02802:Kank1 UTSW 19 25,388,963 (GRCm39) missense probably damaging 1.00
R0107:Kank1 UTSW 19 25,407,730 (GRCm39) unclassified probably benign
R0190:Kank1 UTSW 19 25,386,647 (GRCm39) missense probably benign 0.00
R0330:Kank1 UTSW 19 25,401,677 (GRCm39) missense probably benign 0.00
R0368:Kank1 UTSW 19 25,387,967 (GRCm39) nonsense probably null
R0399:Kank1 UTSW 19 25,388,606 (GRCm39) missense probably benign 0.00
R0426:Kank1 UTSW 19 25,388,837 (GRCm39) missense probably damaging 1.00
R0483:Kank1 UTSW 19 25,403,357 (GRCm39) unclassified probably benign
R1394:Kank1 UTSW 19 25,405,528 (GRCm39) missense probably damaging 1.00
R1495:Kank1 UTSW 19 25,387,713 (GRCm39) missense probably damaging 0.98
R1681:Kank1 UTSW 19 25,387,668 (GRCm39) missense possibly damaging 0.89
R1698:Kank1 UTSW 19 25,388,681 (GRCm39) missense probably benign 0.11
R1830:Kank1 UTSW 19 25,388,396 (GRCm39) missense probably benign 0.00
R1866:Kank1 UTSW 19 25,388,813 (GRCm39) missense probably benign 0.04
R2138:Kank1 UTSW 19 25,389,117 (GRCm39) missense probably benign 0.00
R2139:Kank1 UTSW 19 25,389,117 (GRCm39) missense probably benign 0.00
R2420:Kank1 UTSW 19 25,387,821 (GRCm39) missense probably damaging 1.00
R3153:Kank1 UTSW 19 25,388,052 (GRCm39) missense possibly damaging 0.89
R4164:Kank1 UTSW 19 25,388,436 (GRCm39) missense probably benign 0.10
R4670:Kank1 UTSW 19 25,387,944 (GRCm39) missense probably benign 0.00
R4685:Kank1 UTSW 19 25,387,398 (GRCm39) missense possibly damaging 0.66
R4843:Kank1 UTSW 19 25,408,371 (GRCm39) missense probably damaging 1.00
R4981:Kank1 UTSW 19 25,388,759 (GRCm39) missense probably benign 0.19
R5189:Kank1 UTSW 19 25,401,545 (GRCm39) missense probably damaging 1.00
R5280:Kank1 UTSW 19 25,388,669 (GRCm39) missense probably benign 0.01
R5330:Kank1 UTSW 19 25,388,693 (GRCm39) missense probably damaging 1.00
R5331:Kank1 UTSW 19 25,388,693 (GRCm39) missense probably damaging 1.00
R5435:Kank1 UTSW 19 25,388,507 (GRCm39) missense probably benign 0.04
R5500:Kank1 UTSW 19 25,401,696 (GRCm39) missense possibly damaging 0.46
R5894:Kank1 UTSW 19 25,401,564 (GRCm39) missense probably damaging 1.00
R6087:Kank1 UTSW 19 25,387,088 (GRCm39) missense probably benign 0.41
R6357:Kank1 UTSW 19 25,388,717 (GRCm39) missense probably benign 0.36
R6490:Kank1 UTSW 19 25,387,449 (GRCm39) missense probably damaging 1.00
R6504:Kank1 UTSW 19 25,405,518 (GRCm39) missense probably damaging 1.00
R6942:Kank1 UTSW 19 25,401,537 (GRCm39) missense possibly damaging 0.88
R7037:Kank1 UTSW 19 25,407,705 (GRCm39) missense probably damaging 1.00
R7405:Kank1 UTSW 19 25,387,683 (GRCm39) nonsense probably null
R7486:Kank1 UTSW 19 25,388,193 (GRCm39) missense probably damaging 0.99
R7602:Kank1 UTSW 19 25,399,525 (GRCm39) missense probably benign 0.01
R7701:Kank1 UTSW 19 25,389,129 (GRCm39) critical splice donor site probably null
R7765:Kank1 UTSW 19 25,388,569 (GRCm39) frame shift probably null
R7766:Kank1 UTSW 19 25,388,569 (GRCm39) frame shift probably null
R7768:Kank1 UTSW 19 25,388,569 (GRCm39) frame shift probably null
R7919:Kank1 UTSW 19 25,408,439 (GRCm39) missense probably damaging 1.00
R7978:Kank1 UTSW 19 25,388,569 (GRCm39) frame shift probably null
R8017:Kank1 UTSW 19 25,388,569 (GRCm39) frame shift probably null
R8017:Kank1 UTSW 19 25,388,568 (GRCm39) frame shift probably null
R8020:Kank1 UTSW 19 25,388,569 (GRCm39) frame shift probably null
R8150:Kank1 UTSW 19 25,388,163 (GRCm39) missense possibly damaging 0.88
R8322:Kank1 UTSW 19 25,355,842 (GRCm39) start gained probably benign
R8374:Kank1 UTSW 19 25,389,005 (GRCm39) missense probably damaging 0.97
R8705:Kank1 UTSW 19 25,388,907 (GRCm39) missense probably damaging 1.00
R8855:Kank1 UTSW 19 25,388,702 (GRCm39) missense possibly damaging 0.87
R8866:Kank1 UTSW 19 25,388,702 (GRCm39) missense possibly damaging 0.87
R8891:Kank1 UTSW 19 25,387,439 (GRCm39) missense probably benign 0.32
R8894:Kank1 UTSW 19 25,408,378 (GRCm39) missense probably damaging 1.00
R8917:Kank1 UTSW 19 25,386,928 (GRCm39) missense probably damaging 0.99
R9217:Kank1 UTSW 19 25,386,944 (GRCm39) missense possibly damaging 0.92
R9301:Kank1 UTSW 19 25,388,798 (GRCm39) missense probably benign 0.00
R9431:Kank1 UTSW 19 25,387,866 (GRCm39) missense probably damaging 1.00
R9603:Kank1 UTSW 19 25,408,289 (GRCm39) missense possibly damaging 0.95
R9680:Kank1 UTSW 19 25,388,138 (GRCm39) missense probably damaging 1.00
R9746:Kank1 UTSW 19 25,386,872 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGAGTTTCTAAGTGCAGGCTC -3'
(R):5'- GGGGAAATGTACCACACCTCTC -3'

Sequencing Primer
(F):5'- TGCAGGCTCTAAACCATTGG -3'
(R):5'- AATGTACCACACCTCTCTCTGATTTC -3'
Posted On 2020-09-15