Incidental Mutation 'R7974:Ablim1'
ID 650815
Institutional Source Beutler Lab
Gene Symbol Ablim1
Ensembl Gene ENSMUSG00000025085
Gene Name actin-binding LIM protein 1
Synonyms 4833406P10Rik, 9330196J19Rik, 2610209L21Rik, Limab1, 2210411C18Rik, abLIM-S, abLIM-M, abLIM-L
MMRRC Submission 046017-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.355) question?
Stock # R7974 (G1)
Quality Score 225.009
Status Validated
Chromosome 19
Chromosomal Location 57021165-57303351 bp(-) (GRCm39)
Type of Mutation critical splice acceptor site
DNA Base Change (assembly) C to T at 57033405 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000078336 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079360] [ENSMUST00000099294] [ENSMUST00000104902] [ENSMUST00000111526] [ENSMUST00000111528] [ENSMUST00000111529] [ENSMUST00000111544] [ENSMUST00000111546] [ENSMUST00000111550] [ENSMUST00000111555] [ENSMUST00000111558] [ENSMUST00000111559]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000079360
SMART Domains Protein: ENSMUSP00000078336
Gene: ENSMUSG00000025085

DomainStartEndE-ValueType
low complexity region 3 16 N/A INTRINSIC
LIM 98 149 1.14e-9 SMART
LIM 157 209 1.37e-12 SMART
LIM 225 276 1.12e-17 SMART
LIM 284 336 5.87e-12 SMART
Pfam:AbLIM_anchor 393 825 1.9e-139 PFAM
VHP 826 861 1.22e-17 SMART
Predicted Effect probably null
Transcript: ENSMUST00000099294
SMART Domains Protein: ENSMUSP00000096897
Gene: ENSMUSG00000025085

DomainStartEndE-ValueType
LIM 22 73 1.14e-9 SMART
LIM 81 133 1.37e-12 SMART
LIM 149 200 1.12e-17 SMART
LIM 208 260 5.87e-12 SMART
low complexity region 284 293 N/A INTRINSIC
coiled coil region 467 491 N/A INTRINSIC
low complexity region 516 531 N/A INTRINSIC
VHP 619 654 1.22e-17 SMART
Predicted Effect probably null
Transcript: ENSMUST00000104902
SMART Domains Protein: ENSMUSP00000127818
Gene: ENSMUSG00000025085

DomainStartEndE-ValueType
Blast:LIM 1 20 3e-7 BLAST
PDB:1WIG|A 1 28 1e-8 PDB
low complexity region 88 97 N/A INTRINSIC
low complexity region 219 235 N/A INTRINSIC
coiled coil region 358 382 N/A INTRINSIC
low complexity region 407 422 N/A INTRINSIC
VHP 510 545 1.22e-17 SMART
Predicted Effect probably null
Transcript: ENSMUST00000111526
SMART Domains Protein: ENSMUSP00000107151
Gene: ENSMUSG00000025085

DomainStartEndE-ValueType
Blast:LIM 1 20 2e-7 BLAST
PDB:1WIG|A 1 28 6e-9 PDB
coiled coil region 213 237 N/A INTRINSIC
low complexity region 262 277 N/A INTRINSIC
VHP 365 400 1.22e-17 SMART
Predicted Effect probably null
Transcript: ENSMUST00000111528
SMART Domains Protein: ENSMUSP00000107153
Gene: ENSMUSG00000025085

DomainStartEndE-ValueType
Blast:LIM 1 20 3e-7 BLAST
PDB:1WIG|A 1 28 8e-9 PDB
low complexity region 72 81 N/A INTRINSIC
coiled coil region 267 291 N/A INTRINSIC
low complexity region 316 331 N/A INTRINSIC
VHP 419 454 1.22e-17 SMART
Predicted Effect probably null
Transcript: ENSMUST00000111529
SMART Domains Protein: ENSMUSP00000107154
Gene: ENSMUSG00000025085

DomainStartEndE-ValueType
Blast:LIM 1 20 3e-7 BLAST
PDB:1WIG|A 1 28 8e-9 PDB
low complexity region 44 53 N/A INTRINSIC
coiled coil region 239 263 N/A INTRINSIC
low complexity region 288 303 N/A INTRINSIC
VHP 391 426 1.22e-17 SMART
Predicted Effect probably null
Transcript: ENSMUST00000111544
SMART Domains Protein: ENSMUSP00000107169
Gene: ENSMUSG00000025085

DomainStartEndE-ValueType
LIM 22 73 1.14e-9 SMART
LIM 81 133 1.37e-12 SMART
LIM 149 200 1.12e-17 SMART
LIM 208 260 5.87e-12 SMART
low complexity region 284 293 N/A INTRINSIC
low complexity region 422 427 N/A INTRINSIC
coiled coil region 481 505 N/A INTRINSIC
low complexity region 530 545 N/A INTRINSIC
VHP 633 668 1.22e-17 SMART
Predicted Effect probably null
Transcript: ENSMUST00000111546
SMART Domains Protein: ENSMUSP00000107172
Gene: ENSMUSG00000025085

DomainStartEndE-ValueType
LIM 22 73 5.7e-12 SMART
LIM 81 133 6.6e-15 SMART
LIM 149 200 5.4e-20 SMART
LIM 208 260 2.8e-14 SMART
low complexity region 284 293 N/A INTRINSIC
coiled coil region 514 538 N/A INTRINSIC
low complexity region 563 578 N/A INTRINSIC
VHP 666 700 1.2e-15 SMART
Predicted Effect probably null
Transcript: ENSMUST00000111550
SMART Domains Protein: ENSMUSP00000107175
Gene: ENSMUSG00000025085

DomainStartEndE-ValueType
LIM 22 73 1.14e-9 SMART
LIM 81 133 1.37e-12 SMART
LIM 149 200 1.12e-17 SMART
LIM 208 260 5.87e-12 SMART
low complexity region 312 321 N/A INTRINSIC
coiled coil region 495 519 N/A INTRINSIC
low complexity region 544 559 N/A INTRINSIC
VHP 647 682 1.22e-17 SMART
Predicted Effect probably null
Transcript: ENSMUST00000111555
SMART Domains Protein: ENSMUSP00000107180
Gene: ENSMUSG00000025085

DomainStartEndE-ValueType
low complexity region 3 16 N/A INTRINSIC
LIM 98 149 1.14e-9 SMART
LIM 157 209 1.37e-12 SMART
LIM 225 276 1.12e-17 SMART
LIM 284 336 5.87e-12 SMART
low complexity region 360 369 N/A INTRINSIC
coiled coil region 590 614 N/A INTRINSIC
low complexity region 639 654 N/A INTRINSIC
VHP 742 777 1.22e-17 SMART
Predicted Effect probably null
Transcript: ENSMUST00000111558
SMART Domains Protein: ENSMUSP00000107183
Gene: ENSMUSG00000025085

DomainStartEndE-ValueType
LIM 35 86 1.14e-9 SMART
LIM 94 146 1.37e-12 SMART
LIM 162 213 1.12e-17 SMART
LIM 221 273 5.87e-12 SMART
low complexity region 325 334 N/A INTRINSIC
low complexity region 498 503 N/A INTRINSIC
coiled coil region 557 581 N/A INTRINSIC
low complexity region 606 621 N/A INTRINSIC
VHP 709 744 1.22e-17 SMART
Predicted Effect probably null
Transcript: ENSMUST00000111559
SMART Domains Protein: ENSMUSP00000107184
Gene: ENSMUSG00000025085

DomainStartEndE-ValueType
LIM 35 86 1.14e-9 SMART
LIM 94 146 1.37e-12 SMART
LIM 162 213 1.12e-17 SMART
LIM 221 273 5.87e-12 SMART
low complexity region 297 306 N/A INTRINSIC
coiled coil region 527 551 N/A INTRINSIC
low complexity region 576 591 N/A INTRINSIC
VHP 679 714 1.22e-17 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (64/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytoskeletal LIM protein that binds to actin filaments via a domain that is homologous to erythrocyte dematin. LIM domains, found in over 60 proteins, play key roles in the regulation of developmental pathways. LIM domains also function as protein-binding interfaces, mediating specific protein-protein interactions. The protein encoded by this gene could mediate such interactions between actin filaments and cytoplasmic targets. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutant mice lacking the retina-specific isoform are healthy, fertile, and show no defects in retinal development or retinofugal projections. [provided by MGI curators]
Allele List at MGI

All alleles(6) : Targeted, knock-out(1) Targeted, other(1) Gene trapped(4)

Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts19 A T 18: 59,144,094 (GRCm39) Q892L possibly damaging Het
Adamts9 A G 6: 92,886,668 (GRCm39) probably null Het
Aftph T C 11: 20,648,233 (GRCm39) *686W probably null Het
AI661453 T C 17: 47,777,006 (GRCm39) L244P unknown Het
Ankar C A 1: 72,738,138 (GRCm39) E15* probably null Het
Ankrd39 A G 1: 36,585,999 (GRCm39) probably benign Het
Arsi A G 18: 61,045,478 (GRCm39) D56G probably damaging Het
Blmh T C 11: 76,856,729 (GRCm39) I245T possibly damaging Het
Ccr6 T C 17: 8,475,056 (GRCm39) F87S probably damaging Het
Cdc42ep2 T C 19: 5,968,523 (GRCm39) K61E probably damaging Het
Celsr1 C T 15: 85,915,231 (GRCm39) G914D probably damaging Het
Cep126 T A 9: 8,120,764 (GRCm39) K86N probably benign Het
Cfap70 A T 14: 20,470,818 (GRCm39) F532I probably damaging Het
Cpsf3 T A 12: 21,358,006 (GRCm39) L506Q probably damaging Het
Dct A C 14: 118,277,067 (GRCm39) I273S probably damaging Het
Dsel T C 1: 111,788,229 (GRCm39) I769V probably benign Het
Dus2 G A 8: 106,762,652 (GRCm39) E138K probably benign Het
Emsy A G 7: 98,279,425 (GRCm39) S305P possibly damaging Het
Erp27 A T 6: 136,885,063 (GRCm39) V245D probably damaging Het
Fez1 C A 9: 36,755,244 (GRCm39) T81K probably damaging Het
Gli3 A C 13: 15,900,841 (GRCm39) Q1409H probably benign Het
Hdac9 T C 12: 34,353,219 (GRCm39) S664G possibly damaging Het
Hibadh A G 6: 52,534,880 (GRCm39) S167P probably benign Het
Hsdl1 A G 8: 120,293,072 (GRCm39) V121A probably benign Het
Ift70a1 T C 2: 75,810,688 (GRCm39) H465R probably damaging Het
Ighv1-18 A C 12: 114,646,669 (GRCm39) I6S possibly damaging Het
Iqcm T A 8: 76,281,520 (GRCm39) M1K probably null Het
Itch T C 2: 155,034,079 (GRCm39) F417S probably damaging Het
Itpr1 C T 6: 108,500,366 (GRCm39) T2653I possibly damaging Het
Kank1 T G 19: 25,401,584 (GRCm39) Y1064D probably damaging Het
Kmt2c T C 5: 25,505,561 (GRCm39) Q3249R probably damaging Het
Lefty1 T C 1: 180,765,385 (GRCm39) C318R probably damaging Het
Lmbr1l C T 15: 98,809,500 (GRCm39) V147I probably benign Het
Meig1 C A 2: 3,412,911 (GRCm39) E37* probably null Het
Mpp3 A G 11: 101,899,180 (GRCm39) probably null Het
Muc17 T C 5: 137,175,664 (GRCm39) N2S Het
Mup7 T C 4: 60,067,518 (GRCm39) E199G possibly damaging Het
Nol4 G C 18: 22,852,082 (GRCm39) Y275* probably null Het
Nrxn1 G A 17: 91,008,207 (GRCm39) P429S probably damaging Het
Or14j8 T C 17: 38,263,672 (GRCm39) Y81C probably damaging Het
Pfkl A T 10: 77,829,996 (GRCm39) F367L probably damaging Het
Pik3cg T C 12: 32,254,031 (GRCm39) E652G probably benign Het
Prkag3 A G 1: 74,783,980 (GRCm39) I301T probably benign Het
Rcn1 G A 2: 105,224,055 (GRCm39) P163L probably benign Het
Slc1a7 G A 4: 107,869,473 (GRCm39) V513M probably benign Het
Slc37a2 A T 9: 37,150,421 (GRCm39) probably null Het
Slc9b1 C T 3: 135,099,791 (GRCm39) T437I possibly damaging Het
Smap1 T G 1: 23,888,522 (GRCm39) T248P probably benign Het
Smpd3 A C 8: 106,982,254 (GRCm39) C617G probably benign Het
Spata20 T C 11: 94,374,966 (GRCm39) N212S possibly damaging Het
Sphkap A C 1: 83,256,683 (GRCm39) C355W probably damaging Het
Spopfm2 T C 3: 94,082,848 (GRCm39) K321R probably benign Het
Spsb1 T A 4: 149,991,566 (GRCm39) M1L probably damaging Het
Srebf2 C T 15: 82,062,966 (GRCm39) R468C probably damaging Het
Stxbp5 A C 10: 9,646,439 (GRCm39) probably null Het
Taar5 G C 10: 23,847,120 (GRCm39) D173H possibly damaging Het
Tfrc A G 16: 32,440,101 (GRCm39) D438G probably null Het
Tinag A T 9: 76,907,131 (GRCm39) I368K probably benign Het
Tm9sf1 A G 14: 55,873,906 (GRCm39) W531R probably damaging Het
Tnc G T 4: 63,918,961 (GRCm39) P1154Q possibly damaging Het
Toporsl A G 4: 52,611,645 (GRCm39) R513G probably damaging Het
Vat1 A G 11: 101,356,956 (GRCm39) S2P probably benign Het
Vmn2r107 C G 17: 20,577,270 (GRCm39) P423A probably benign Het
Vmn2r2 T A 3: 64,024,808 (GRCm39) E591V probably damaging Het
Vmn2r62 T A 7: 42,437,281 (GRCm39) Y401F probably damaging Het
Vmn2r62 G A 7: 42,414,031 (GRCm39) T804I probably damaging Het
Vmn2r89 A T 14: 51,693,459 (GRCm39) I270F probably damaging Het
Zfp418 T C 7: 7,185,167 (GRCm39) F377L possibly damaging Het
Zkscan5 T C 5: 145,144,502 (GRCm39) S182P unknown Het
Other mutations in Ablim1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00422:Ablim1 APN 19 57,056,618 (GRCm39) missense probably damaging 1.00
IGL00466:Ablim1 APN 19 57,056,618 (GRCm39) missense probably damaging 1.00
IGL00478:Ablim1 APN 19 57,056,618 (GRCm39) missense probably damaging 1.00
IGL00847:Ablim1 APN 19 57,140,722 (GRCm39) missense possibly damaging 0.59
IGL01063:Ablim1 APN 19 57,049,760 (GRCm39) missense probably damaging 1.00
IGL01304:Ablim1 APN 19 57,204,153 (GRCm39) missense probably benign
IGL01385:Ablim1 APN 19 57,057,346 (GRCm39) missense probably damaging 1.00
IGL01707:Ablim1 APN 19 57,027,879 (GRCm39) missense probably damaging 1.00
IGL02386:Ablim1 APN 19 57,123,086 (GRCm39) missense probably damaging 1.00
IGL02427:Ablim1 APN 19 57,068,312 (GRCm39) splice site probably benign
IGL02498:Ablim1 APN 19 57,140,751 (GRCm39) nonsense probably null
A9681:Ablim1 UTSW 19 57,161,755 (GRCm39) critical splice donor site probably null
R0089:Ablim1 UTSW 19 57,031,463 (GRCm39) missense probably damaging 1.00
R0226:Ablim1 UTSW 19 57,032,302 (GRCm39) missense probably damaging 1.00
R1419:Ablim1 UTSW 19 57,123,065 (GRCm39) missense probably damaging 1.00
R1473:Ablim1 UTSW 19 57,056,668 (GRCm39) missense probably damaging 1.00
R1587:Ablim1 UTSW 19 57,071,979 (GRCm39) start codon destroyed probably null 0.99
R1588:Ablim1 UTSW 19 57,071,979 (GRCm39) start codon destroyed probably null 0.99
R1935:Ablim1 UTSW 19 57,204,397 (GRCm39) start gained probably null
R1936:Ablim1 UTSW 19 57,204,397 (GRCm39) start gained probably null
R2021:Ablim1 UTSW 19 57,035,450 (GRCm39) missense probably damaging 0.98
R2110:Ablim1 UTSW 19 57,032,245 (GRCm39) missense possibly damaging 0.83
R2270:Ablim1 UTSW 19 57,065,863 (GRCm39) missense possibly damaging 0.58
R2509:Ablim1 UTSW 19 57,140,791 (GRCm39) missense probably damaging 1.00
R3621:Ablim1 UTSW 19 57,140,735 (GRCm39) missense probably damaging 0.97
R3732:Ablim1 UTSW 19 57,037,892 (GRCm39) critical splice donor site probably null
R3732:Ablim1 UTSW 19 57,037,892 (GRCm39) critical splice donor site probably null
R3733:Ablim1 UTSW 19 57,037,892 (GRCm39) critical splice donor site probably null
R3734:Ablim1 UTSW 19 57,037,892 (GRCm39) critical splice donor site probably null
R3878:Ablim1 UTSW 19 57,025,642 (GRCm39) splice site probably null
R4354:Ablim1 UTSW 19 57,143,710 (GRCm39) missense probably damaging 1.00
R4543:Ablim1 UTSW 19 57,065,874 (GRCm39) missense possibly damaging 0.87
R4749:Ablim1 UTSW 19 57,204,153 (GRCm39) missense probably benign
R4860:Ablim1 UTSW 19 57,068,298 (GRCm39) missense probably damaging 1.00
R4860:Ablim1 UTSW 19 57,068,298 (GRCm39) missense probably damaging 1.00
R5072:Ablim1 UTSW 19 57,062,285 (GRCm39) critical splice donor site probably null
R5277:Ablim1 UTSW 19 57,143,693 (GRCm39) missense probably damaging 1.00
R5331:Ablim1 UTSW 19 57,143,681 (GRCm39) missense probably damaging 1.00
R5354:Ablim1 UTSW 19 57,119,355 (GRCm39) missense probably benign 0.07
R5893:Ablim1 UTSW 19 57,204,285 (GRCm39) missense probably benign 0.07
R5958:Ablim1 UTSW 19 57,030,367 (GRCm39) missense probably damaging 1.00
R6435:Ablim1 UTSW 19 57,049,787 (GRCm39) missense possibly damaging 0.69
R6460:Ablim1 UTSW 19 57,068,271 (GRCm39) missense possibly damaging 0.96
R6642:Ablim1 UTSW 19 57,119,284 (GRCm39) missense probably benign 0.03
R6662:Ablim1 UTSW 19 57,062,285 (GRCm39) critical splice donor site probably null
R6705:Ablim1 UTSW 19 57,204,253 (GRCm39) missense probably benign 0.01
R7111:Ablim1 UTSW 19 57,062,309 (GRCm39) missense probably benign 0.05
R7291:Ablim1 UTSW 19 57,204,340 (GRCm39) missense probably benign
R7363:Ablim1 UTSW 19 57,204,173 (GRCm39) missense probably benign 0.10
R7901:Ablim1 UTSW 19 57,119,434 (GRCm39) splice site probably null
R8079:Ablim1 UTSW 19 57,170,656 (GRCm39) critical splice donor site probably null
R8087:Ablim1 UTSW 19 57,170,688 (GRCm39) missense
R8120:Ablim1 UTSW 19 57,035,360 (GRCm39) missense probably benign 0.00
R8277:Ablim1 UTSW 19 57,204,351 (GRCm39) missense probably benign 0.10
R8339:Ablim1 UTSW 19 57,032,281 (GRCm39) missense probably benign 0.00
R8536:Ablim1 UTSW 19 57,170,718 (GRCm39) intron probably benign
R8857:Ablim1 UTSW 19 57,119,287 (GRCm39) missense possibly damaging 0.84
R8875:Ablim1 UTSW 19 57,119,386 (GRCm39) missense probably benign 0.00
R8983:Ablim1 UTSW 19 57,227,644 (GRCm39) missense probably benign 0.02
R9055:Ablim1 UTSW 19 57,030,398 (GRCm39) missense probably benign 0.10
R9475:Ablim1 UTSW 19 57,227,612 (GRCm39) missense probably benign 0.00
R9505:Ablim1 UTSW 19 57,185,782 (GRCm39) intron probably benign
R9695:Ablim1 UTSW 19 57,170,739 (GRCm39) missense
R9762:Ablim1 UTSW 19 57,025,691 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCCTACTGGACCCTTGAGG -3'
(R):5'- CTGTTAGAGGAGCTCTGAGAAGC -3'

Sequencing Primer
(F):5'- ACTGGACCCTTGAGGCTCTTG -3'
(R):5'- CAGACCCGGTGCTGAGTTG -3'
Posted On 2020-09-15