Incidental Mutation 'R7975:Aox2'
ID 650816
Institutional Source Beutler Lab
Gene Symbol Aox2
Ensembl Gene ENSMUSG00000079554
Gene Name aldehyde oxidase 2
Synonyms Aox3l1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock # R7975 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 58278326-58380259 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 58309028 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Lysine at position 635 (I635K)
Ref Sequence ENSEMBL: ENSMUSP00000110006 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114366]
AlphaFold Q5SGK3
Predicted Effect probably benign
Transcript: ENSMUST00000114366
AA Change: I635K

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000110006
Gene: ENSMUSG00000079554
AA Change: I635K

DomainStartEndE-ValueType
Pfam:Fer2 13 83 3.4e-9 PFAM
Pfam:Fer2_2 92 166 4.2e-30 PFAM
Pfam:FAD_binding_5 241 421 5.1e-46 PFAM
CO_deh_flav_C 428 532 1.4e-23 SMART
Ald_Xan_dh_C 604 707 4.64e-47 SMART
Pfam:Ald_Xan_dh_C2 717 1251 1.3e-178 PFAM
low complexity region 1257 1271 N/A INTRINSIC
low complexity region 1285 1303 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.3%
Validation Efficiency 100% (53/53)
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik C T 10: 82,283,989 A4396T possibly damaging Het
Ano4 T C 10: 89,116,985 I60V possibly damaging Het
Ano5 T A 7: 51,566,538 M381K probably null Het
BC067074 A G 13: 113,319,307 H629R Het
Bdp1 C T 13: 100,020,376 C2436Y probably benign Het
Bod1l T C 5: 41,816,277 R2565G possibly damaging Het
Brd2 A T 17: 34,115,450 I245N probably damaging Het
Capn9 G A 8: 124,598,776 V258M probably damaging Het
Ccar2 C G 14: 70,143,469 C324S possibly damaging Het
Cd209b A T 8: 3,925,948 I71N probably benign Het
Cdk12 A T 11: 98,221,102 I729F unknown Het
Celf1 T G 2: 91,001,078 V84G probably damaging Het
Cgn G T 3: 94,764,529 A965E probably benign Het
Cgnl1 T C 9: 71,725,322 E249G probably benign Het
Cyp2j8 T C 4: 96,470,539 N381S possibly damaging Het
Dmtf1 T C 5: 9,129,169 D343G probably damaging Het
Fhl5 T A 4: 25,214,730 I16F probably benign Het
Gatd1 A G 7: 141,409,868 F143S probably damaging Het
Gbp10 C T 5: 105,221,101 G291R probably benign Het
Gm28168 T C 1: 117,948,090 Y150H probably benign Het
Gm3543 T C 14: 41,980,165 M121V probably benign Het
Gramd3 A G 18: 56,485,379 T220A probably benign Het
Gstcd A G 3: 133,072,102 L316P probably damaging Het
Hspg2 G A 4: 137,555,221 G3424D probably benign Het
Ifi209 C T 1: 173,641,156 S184F probably benign Het
Ino80 A T 2: 119,456,467 probably null Het
Kcnd3 G A 3: 105,458,994 R60H probably damaging Het
Kif21b T C 1: 136,171,173 C1400R probably damaging Het
Lama3 C T 18: 12,537,739 P794L probably damaging Het
Lgals4 A G 7: 28,840,921 I214V probably benign Het
Lipo4 A T 19: 33,512,628 L158Q probably damaging Het
Ltv1 A G 10: 13,190,709 Y58H probably damaging Het
Mitf T C 6: 98,018,029 S479P probably benign Het
Mthfr A T 4: 148,043,463 D132V probably damaging Het
Mtrr T C 13: 68,579,547 probably null Het
Neb T A 2: 52,160,666 H6660L probably benign Het
Nhlrc3 A T 3: 53,453,545 V263E probably damaging Het
Oas1h G A 5: 120,871,827 V322M probably damaging Het
Olfr1234 C T 2: 89,363,069 R120H probably benign Het
Olfr165 T A 16: 19,407,551 D155V probably damaging Het
Olfr519 A T 7: 108,893,812 Y203* probably null Het
Pappa A T 4: 65,294,468 D1121V probably damaging Het
Pax5 A G 4: 44,537,465 S352P probably damaging Het
Piezo1 C A 8: 122,495,765 R915L Het
R3hcc1 T C 14: 69,707,144 D7G probably damaging Het
Rasgrp2 A G 19: 6,408,559 K429E probably damaging Het
Scn10a A G 9: 119,672,220 F166S probably benign Het
Scn9a T G 2: 66,484,253 N1707T probably damaging Het
Sec23ip T C 7: 128,762,477 F493S probably damaging Het
Slc1a7 G A 4: 108,012,276 V513M probably benign Het
Slfn4 A T 11: 83,187,156 I257F possibly damaging Het
Smarcal1 T A 1: 72,612,991 D637E probably benign Het
Smpd3 A C 8: 106,255,622 C617G probably benign Het
Sos2 A T 12: 69,593,040 F990L probably benign Het
Syne1 T C 10: 5,031,786 T844A probably benign Het
Tph1 G A 7: 46,657,254 R145C probably damaging Het
Ubap2l G A 3: 90,038,769 probably null Het
Vmn2r50 T C 7: 10,037,345 I810V probably benign Het
Vmn2r59 T C 7: 42,043,775 D467G probably damaging Het
Zfp618 T A 4: 63,131,115 N417K possibly damaging Het
Other mutations in Aox2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01014:Aox2 APN 1 58322801 missense possibly damaging 0.73
IGL01288:Aox2 APN 1 58294407 missense probably damaging 0.99
IGL01383:Aox2 APN 1 58294305 missense probably benign 0.09
IGL01734:Aox2 APN 1 58354310 missense possibly damaging 0.95
IGL01793:Aox2 APN 1 58336624 missense possibly damaging 0.79
IGL01834:Aox2 APN 1 58309024 missense possibly damaging 0.90
IGL01924:Aox2 APN 1 58287743 missense possibly damaging 0.90
IGL02591:Aox2 APN 1 58358999 nonsense probably null
IGL02645:Aox2 APN 1 58334724 missense probably damaging 1.00
IGL02710:Aox2 APN 1 58334769 critical splice donor site probably null
IGL02801:Aox2 APN 1 58354177 missense probably damaging 1.00
IGL02988:Aox2 APN 1 58337350 missense probably benign
IGL03104:Aox2 APN 1 58282759 missense probably benign
IGL03121:Aox2 APN 1 58358954 missense probably damaging 1.00
IGL03191:Aox2 APN 1 58359069 missense probably null 0.98
IGL03236:Aox2 APN 1 58309997 nonsense probably null
IGL03409:Aox2 APN 1 58354429 missense possibly damaging 0.91
PIT4362001:Aox2 UTSW 1 58282680 missense probably damaging 1.00
R0035:Aox2 UTSW 1 58354422 missense probably benign 0.00
R0035:Aox2 UTSW 1 58354422 missense probably benign 0.00
R0267:Aox2 UTSW 1 58339446 splice site probably benign
R0388:Aox2 UTSW 1 58354406 missense probably damaging 1.00
R0409:Aox2 UTSW 1 58336624 missense possibly damaging 0.90
R0547:Aox2 UTSW 1 58310042 missense probably damaging 0.96
R0630:Aox2 UTSW 1 58337321 splice site probably benign
R0726:Aox2 UTSW 1 58334782 splice site probably benign
R0734:Aox2 UTSW 1 58305341 missense probably benign 0.22
R0831:Aox2 UTSW 1 58339683 missense probably benign 0.28
R0961:Aox2 UTSW 1 58310071 missense probably benign 0.00
R1404:Aox2 UTSW 1 58346212 splice site probably benign
R1512:Aox2 UTSW 1 58307351 missense probably benign 0.00
R1573:Aox2 UTSW 1 58309027 missense probably benign 0.00
R1592:Aox2 UTSW 1 58300694 missense probably benign 0.00
R1747:Aox2 UTSW 1 58339592 missense probably benign 0.01
R1768:Aox2 UTSW 1 58354195 missense probably benign 0.00
R1809:Aox2 UTSW 1 58294325 missense probably benign
R1823:Aox2 UTSW 1 58312359 missense probably benign 0.02
R1834:Aox2 UTSW 1 58308991 missense probably benign 0.08
R1835:Aox2 UTSW 1 58308991 missense probably benign 0.08
R1836:Aox2 UTSW 1 58308991 missense probably benign 0.08
R2219:Aox2 UTSW 1 58349130 splice site probably null
R2220:Aox2 UTSW 1 58349130 splice site probably null
R2508:Aox2 UTSW 1 58343673 missense probably benign 0.38
R2942:Aox2 UTSW 1 58337381 missense probably benign 0.03
R2967:Aox2 UTSW 1 58322834 missense probably damaging 0.96
R3082:Aox2 UTSW 1 58283600 splice site probably benign
R3161:Aox2 UTSW 1 58304438 missense possibly damaging 0.91
R3408:Aox2 UTSW 1 58343668 missense probably benign 0.32
R3803:Aox2 UTSW 1 58289899 splice site probably null
R3894:Aox2 UTSW 1 58334678 critical splice acceptor site probably null
R4214:Aox2 UTSW 1 58307444 critical splice donor site probably null
R4249:Aox2 UTSW 1 58299819 missense probably benign 0.01
R4666:Aox2 UTSW 1 58304597 nonsense probably null
R4668:Aox2 UTSW 1 58334694 missense possibly damaging 0.63
R4703:Aox2 UTSW 1 58358957 missense possibly damaging 0.78
R4758:Aox2 UTSW 1 58332582 missense probably benign 0.00
R4890:Aox2 UTSW 1 58334703 missense probably benign 0.11
R4900:Aox2 UTSW 1 58305385 missense probably benign
R4924:Aox2 UTSW 1 58305344 missense probably damaging 1.00
R4970:Aox2 UTSW 1 58310095 splice site probably null
R5112:Aox2 UTSW 1 58310095 splice site probably null
R5987:Aox2 UTSW 1 58307359 missense probably benign 0.00
R6239:Aox2 UTSW 1 58305391 critical splice donor site probably null
R6273:Aox2 UTSW 1 58339672 missense probably benign 0.00
R6291:Aox2 UTSW 1 58330806 missense probably damaging 0.98
R6334:Aox2 UTSW 1 58307407 nonsense probably null
R6764:Aox2 UTSW 1 58350282 missense probably damaging 0.97
R6766:Aox2 UTSW 1 58349068 missense possibly damaging 0.95
R6789:Aox2 UTSW 1 58304485 missense probably benign 0.01
R6804:Aox2 UTSW 1 58304598 missense probably benign 0.04
R7007:Aox2 UTSW 1 58330892 missense probably damaging 1.00
R7015:Aox2 UTSW 1 58282758 missense probably benign 0.00
R7055:Aox2 UTSW 1 58299768 missense probably benign 0.08
R7089:Aox2 UTSW 1 58336649 missense probably benign 0.01
R7157:Aox2 UTSW 1 58283492 missense probably benign 0.00
R7303:Aox2 UTSW 1 58334765 nonsense probably null
R7426:Aox2 UTSW 1 58289983 nonsense probably null
R7762:Aox2 UTSW 1 58349104 missense probably damaging 1.00
R7899:Aox2 UTSW 1 58281237 splice site probably null
R7942:Aox2 UTSW 1 58337431 missense probably damaging 1.00
R8029:Aox2 UTSW 1 58343668 missense probably benign 0.32
R8032:Aox2 UTSW 1 58350283 missense probably benign 0.01
R8147:Aox2 UTSW 1 58300662 missense probably benign 0.02
R8165:Aox2 UTSW 1 58308929 missense probably benign 0.08
R8326:Aox2 UTSW 1 58295887 missense probably benign
R8770:Aox2 UTSW 1 58339604 missense probably benign 0.10
R8973:Aox2 UTSW 1 58289954 missense probably benign 0.34
R9015:Aox2 UTSW 1 58343692 missense probably damaging 1.00
R9097:Aox2 UTSW 1 58287728 missense possibly damaging 0.82
R9101:Aox2 UTSW 1 58332637 missense probably benign 0.03
R9108:Aox2 UTSW 1 58282692 missense probably damaging 1.00
R9180:Aox2 UTSW 1 58339618 nonsense probably null
R9258:Aox2 UTSW 1 58312356 missense probably damaging 1.00
R9293:Aox2 UTSW 1 58322794 missense possibly damaging 0.86
R9519:Aox2 UTSW 1 58334767 missense probably damaging 0.98
R9581:Aox2 UTSW 1 58330896 critical splice donor site probably null
Z1177:Aox2 UTSW 1 58354397 missense possibly damaging 0.69
Predicted Primers PCR Primer
(F):5'- AGGTTCCTGGGCTAACTCTC -3'
(R):5'- CCTCATGGGAAAGTACAGTGAC -3'

Sequencing Primer
(F):5'- GGCTAACTCTCTCTTCCTCTCTAGAG -3'
(R):5'- GTCTTTTTAAGGTGCTGCTACAC -3'
Posted On 2020-09-15