Incidental Mutation 'R7975:Dmtf1'
ID 650837
Institutional Source Beutler Lab
Gene Symbol Dmtf1
Ensembl Gene ENSMUSG00000042508
Gene Name cyclin D binding myb-like transcription factor 1
Synonyms Dmp1
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.497) question?
Stock # R7975 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 9118801-9161776 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 9129169 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 343 (D343G)
Ref Sequence ENSEMBL: ENSMUSP00000071815 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071921] [ENSMUST00000095017] [ENSMUST00000183448] [ENSMUST00000183525] [ENSMUST00000183973] [ENSMUST00000184120] [ENSMUST00000184159] [ENSMUST00000184372] [ENSMUST00000184401] [ENSMUST00000184620] [ENSMUST00000184888] [ENSMUST00000196029]
AlphaFold Q8CE22
Predicted Effect probably damaging
Transcript: ENSMUST00000071921
AA Change: D343G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000071815
Gene: ENSMUSG00000042508
AA Change: D343G

DomainStartEndE-ValueType
SANT 223 270 2.52e-10 SMART
SANT 272 331 6.05e-13 SMART
SANT 335 390 5.36e-5 SMART
low complexity region 522 542 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000095017
AA Change: D343G

PolyPhen 2 Score 0.443 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000092627
Gene: ENSMUSG00000042508
AA Change: D343G

DomainStartEndE-ValueType
SANT 223 270 2.52e-10 SMART
SANT 272 331 6.05e-13 SMART
SANT 335 390 5.36e-5 SMART
low complexity region 452 472 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000183448
SMART Domains Protein: ENSMUSP00000139042
Gene: ENSMUSG00000042508

DomainStartEndE-ValueType
Blast:SANT 152 226 4e-48 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000183525
SMART Domains Protein: ENSMUSP00000139339
Gene: ENSMUSG00000042508

DomainStartEndE-ValueType
Blast:SANT 152 191 2e-20 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000183973
AA Change: D255G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000139361
Gene: ENSMUSG00000042508
AA Change: D255G

DomainStartEndE-ValueType
SANT 135 182 2.52e-10 SMART
SANT 184 243 6.05e-13 SMART
SANT 247 302 5.36e-5 SMART
low complexity region 434 454 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000184120
SMART Domains Protein: ENSMUSP00000138861
Gene: ENSMUSG00000042508

DomainStartEndE-ValueType
Blast:SANT 152 226 6e-48 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000184159
AA Change: D302G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000139231
Gene: ENSMUSG00000042508
AA Change: D302G

DomainStartEndE-ValueType
SANT 182 229 2.52e-10 SMART
SANT 231 290 6.05e-13 SMART
SANT 294 349 5.36e-5 SMART
low complexity region 391 406 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000184370
Predicted Effect probably benign
Transcript: ENSMUST00000184372
SMART Domains Protein: ENSMUSP00000139191
Gene: ENSMUSG00000042508

DomainStartEndE-ValueType
Blast:SANT 152 226 7e-49 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000184401
SMART Domains Protein: ENSMUSP00000139281
Gene: ENSMUSG00000042508

DomainStartEndE-ValueType
Blast:SANT 152 226 4e-48 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000184620
SMART Domains Protein: ENSMUSP00000138816
Gene: ENSMUSG00000042508

DomainStartEndE-ValueType
Blast:SANT 111 185 4e-48 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000184888
SMART Domains Protein: ENSMUSP00000139164
Gene: ENSMUSG00000042508

DomainStartEndE-ValueType
Blast:SANT 152 226 4e-48 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000196029
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.3%
Validation Efficiency 100% (53/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcription factor that contains a cyclin D-binding domain, three central Myb-like repeats, and two flanking acidic transactivation domains at the N- and C-termini. The encoded protein is induced by the oncogenic Ras signaling pathway and functions as a tumor suppressor by activating the transcription of ARF and thus the ARF-p53 pathway to arrest cell growth or induce apoptosis. It also activates the transcription of aminopeptidase N and may play a role in hematopoietic cell differentiation. The transcriptional activity of this protein is regulated by binding of D-cyclins. This gene is hemizygously deleted in approximately 40% of human non-small-cell lung cancer and is a potential prognostic and gene-therapy target for non-small-cell lung cancer. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2008]
PHENOTYPE: Homozygous mutants exhibit partial postnatal lethality, small size, and decreased thymocyte number. Some mutants exhibit seizures and/or obstructive uropathy. Males have dilated seminal vesicles. Mice develop spontaneous tumors in the second year of life, and are susceptible to induced tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik C T 10: 82,283,989 A4396T possibly damaging Het
Ano4 T C 10: 89,116,985 I60V possibly damaging Het
Ano5 T A 7: 51,566,538 M381K probably null Het
Aox2 T A 1: 58,309,028 I635K probably benign Het
BC067074 A G 13: 113,319,307 H629R Het
Bdp1 C T 13: 100,020,376 C2436Y probably benign Het
Bod1l T C 5: 41,816,277 R2565G possibly damaging Het
Brd2 A T 17: 34,115,450 I245N probably damaging Het
Capn9 G A 8: 124,598,776 V258M probably damaging Het
Ccar2 C G 14: 70,143,469 C324S possibly damaging Het
Cd209b A T 8: 3,925,948 I71N probably benign Het
Cdk12 A T 11: 98,221,102 I729F unknown Het
Celf1 T G 2: 91,001,078 V84G probably damaging Het
Cgn G T 3: 94,764,529 A965E probably benign Het
Cgnl1 T C 9: 71,725,322 E249G probably benign Het
Cyp2j8 T C 4: 96,470,539 N381S possibly damaging Het
Fhl5 T A 4: 25,214,730 I16F probably benign Het
Gatd1 A G 7: 141,409,868 F143S probably damaging Het
Gbp10 C T 5: 105,221,101 G291R probably benign Het
Gm28168 T C 1: 117,948,090 Y150H probably benign Het
Gm3543 T C 14: 41,980,165 M121V probably benign Het
Gramd3 A G 18: 56,485,379 T220A probably benign Het
Gstcd A G 3: 133,072,102 L316P probably damaging Het
Hspg2 G A 4: 137,555,221 G3424D probably benign Het
Ifi209 C T 1: 173,641,156 S184F probably benign Het
Ino80 A T 2: 119,456,467 probably null Het
Kcnd3 G A 3: 105,458,994 R60H probably damaging Het
Kif21b T C 1: 136,171,173 C1400R probably damaging Het
Lama3 C T 18: 12,537,739 P794L probably damaging Het
Lgals4 A G 7: 28,840,921 I214V probably benign Het
Lipo4 A T 19: 33,512,628 L158Q probably damaging Het
Ltv1 A G 10: 13,190,709 Y58H probably damaging Het
Mitf T C 6: 98,018,029 S479P probably benign Het
Mthfr A T 4: 148,043,463 D132V probably damaging Het
Mtrr T C 13: 68,579,547 probably null Het
Neb T A 2: 52,160,666 H6660L probably benign Het
Nhlrc3 A T 3: 53,453,545 V263E probably damaging Het
Oas1h G A 5: 120,871,827 V322M probably damaging Het
Olfr1234 C T 2: 89,363,069 R120H probably benign Het
Olfr165 T A 16: 19,407,551 D155V probably damaging Het
Olfr519 A T 7: 108,893,812 Y203* probably null Het
Pappa A T 4: 65,294,468 D1121V probably damaging Het
Pax5 A G 4: 44,537,465 S352P probably damaging Het
Piezo1 C A 8: 122,495,765 R915L Het
R3hcc1 T C 14: 69,707,144 D7G probably damaging Het
Rasgrp2 A G 19: 6,408,559 K429E probably damaging Het
Scn10a A G 9: 119,672,220 F166S probably benign Het
Scn9a T G 2: 66,484,253 N1707T probably damaging Het
Sec23ip T C 7: 128,762,477 F493S probably damaging Het
Slc1a7 G A 4: 108,012,276 V513M probably benign Het
Slfn4 A T 11: 83,187,156 I257F possibly damaging Het
Smarcal1 T A 1: 72,612,991 D637E probably benign Het
Smpd3 A C 8: 106,255,622 C617G probably benign Het
Sos2 A T 12: 69,593,040 F990L probably benign Het
Syne1 T C 10: 5,031,786 T844A probably benign Het
Tph1 G A 7: 46,657,254 R145C probably damaging Het
Ubap2l G A 3: 90,038,769 probably null Het
Vmn2r50 T C 7: 10,037,345 I810V probably benign Het
Vmn2r59 T C 7: 42,043,775 D467G probably damaging Het
Zfp618 T A 4: 63,131,115 N417K possibly damaging Het
Other mutations in Dmtf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02215:Dmtf1 APN 5 9136070 missense probably damaging 1.00
IGL02323:Dmtf1 APN 5 9120056 missense possibly damaging 0.96
IGL02652:Dmtf1 APN 5 9121853 missense probably benign 0.01
IGL02680:Dmtf1 APN 5 9130381 missense probably benign 0.01
IGL02732:Dmtf1 APN 5 9136098 missense possibly damaging 0.77
IGL03002:Dmtf1 APN 5 9140474 missense probably damaging 1.00
IGL03074:Dmtf1 APN 5 9124435 intron probably benign
R0149:Dmtf1 UTSW 5 9132571 missense probably damaging 1.00
R0466:Dmtf1 UTSW 5 9132454 critical splice donor site probably null
R0825:Dmtf1 UTSW 5 9130388 missense probably damaging 1.00
R0973:Dmtf1 UTSW 5 9127987 missense possibly damaging 0.51
R0973:Dmtf1 UTSW 5 9127987 missense possibly damaging 0.51
R0974:Dmtf1 UTSW 5 9127987 missense possibly damaging 0.51
R1068:Dmtf1 UTSW 5 9136109 missense probably damaging 1.00
R1293:Dmtf1 UTSW 5 9140383 splice site probably null
R1478:Dmtf1 UTSW 5 9121404 missense possibly damaging 0.93
R1515:Dmtf1 UTSW 5 9140384 critical splice donor site probably null
R1861:Dmtf1 UTSW 5 9120347 splice site probably null
R1898:Dmtf1 UTSW 5 9128091 missense probably damaging 0.99
R1970:Dmtf1 UTSW 5 9148989 missense probably benign 0.01
R1971:Dmtf1 UTSW 5 9148989 missense probably benign 0.01
R2519:Dmtf1 UTSW 5 9129323 missense possibly damaging 0.71
R3053:Dmtf1 UTSW 5 9129316 missense probably damaging 0.99
R3195:Dmtf1 UTSW 5 9132454 intron probably benign
R4467:Dmtf1 UTSW 5 9136085 missense probably damaging 1.00
R4490:Dmtf1 UTSW 5 9140379 intron probably benign
R4491:Dmtf1 UTSW 5 9140379 intron probably benign
R5007:Dmtf1 UTSW 5 9122439 unclassified probably benign
R5173:Dmtf1 UTSW 5 9140356 intron probably benign
R5184:Dmtf1 UTSW 5 9126641 missense probably benign 0.36
R5646:Dmtf1 UTSW 5 9124515 missense possibly damaging 0.62
R5958:Dmtf1 UTSW 5 9122415 unclassified probably benign
R5977:Dmtf1 UTSW 5 9140451 missense probably damaging 0.99
R6184:Dmtf1 UTSW 5 9126656 missense probably benign
R6887:Dmtf1 UTSW 5 9137149 missense probably damaging 1.00
R6921:Dmtf1 UTSW 5 9130654 intron probably benign
R7242:Dmtf1 UTSW 5 9149016 missense possibly damaging 0.90
R7706:Dmtf1 UTSW 5 9124489 missense possibly damaging 0.86
R7721:Dmtf1 UTSW 5 9126564 missense probably damaging 1.00
R7739:Dmtf1 UTSW 5 9140453 missense probably damaging 1.00
R7742:Dmtf1 UTSW 5 9122457 unclassified probably benign
R7859:Dmtf1 UTSW 5 9128044 missense probably damaging 1.00
R7883:Dmtf1 UTSW 5 9140397 missense probably benign 0.35
R8269:Dmtf1 UTSW 5 9132500 nonsense probably null
R8479:Dmtf1 UTSW 5 9120428 missense probably damaging 0.97
R8782:Dmtf1 UTSW 5 9129168 missense probably damaging 1.00
R9296:Dmtf1 UTSW 5 9140467 missense probably benign 0.01
R9359:Dmtf1 UTSW 5 9121927 missense possibly damaging 0.73
R9372:Dmtf1 UTSW 5 9140399 missense possibly damaging 0.86
R9403:Dmtf1 UTSW 5 9121927 missense possibly damaging 0.73
Predicted Primers PCR Primer
(F):5'- CAAAGAGCTCGCTGTAAACC -3'
(R):5'- GCTGGATCCTGTGATGACTGAG -3'

Sequencing Primer
(F):5'- GCTCGCTGTAAACCACTCAGG -3'
(R):5'- ATTGCTTTCTCAGGGAAATGGACAG -3'
Posted On 2020-09-15