Incidental Mutation 'R7975:Oas1h'
ID650840
Institutional Source Beutler Lab
Gene Symbol Oas1h
Ensembl Gene ENSMUSG00000001168
Gene Name2'-5' oligoadenylate synthetase 1H
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock #R7975 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location120861421-120873506 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 120871827 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 322 (V322M)
Ref Sequence ENSEMBL: ENSMUSP00000072297 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072476] [ENSMUST00000086368] [ENSMUST00000162096] [ENSMUST00000171820]
Predicted Effect probably damaging
Transcript: ENSMUST00000072476
AA Change: V322M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000072297
Gene: ENSMUSG00000001168
AA Change: V322M

DomainStartEndE-ValueType
Pfam:NTP_transf_2 45 146 1.6e-9 PFAM
Pfam:OAS1_C 175 361 2.3e-76 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000086368
SMART Domains Protein: ENSMUSP00000083555
Gene: ENSMUSG00000066861

DomainStartEndE-ValueType
Pfam:NTP_transf_2 38 139 1.6e-13 PFAM
Pfam:OAS1_C 164 349 6.9e-87 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000162096
SMART Domains Protein: ENSMUSP00000124597
Gene: ENSMUSG00000066861

DomainStartEndE-ValueType
Pfam:NTP_transf_2 42 138 1.1e-9 PFAM
Pfam:OAS1_C 163 231 1.4e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171820
SMART Domains Protein: ENSMUSP00000132033
Gene: ENSMUSG00000001168

DomainStartEndE-ValueType
Pfam:NTP_transf_2 46 157 1.6e-7 PFAM
Pfam:OAS1_C 174 236 1e-22 PFAM
Meta Mutation Damage Score 0.6329 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.3%
Validation Efficiency 100% (53/53)
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik C T 10: 82,283,989 A4396T possibly damaging Het
Ano4 T C 10: 89,116,985 I60V possibly damaging Het
Ano5 T A 7: 51,566,538 M381K probably null Het
Aox2 T A 1: 58,309,028 I635K probably benign Het
BC067074 A G 13: 113,319,307 H629R Het
Bdp1 C T 13: 100,020,376 C2436Y probably benign Het
Bod1l T C 5: 41,816,277 R2565G possibly damaging Het
Brd2 A T 17: 34,115,450 I245N probably damaging Het
Capn9 G A 8: 124,598,776 V258M probably damaging Het
Ccar2 C G 14: 70,143,469 C324S possibly damaging Het
Cd209b A T 8: 3,925,948 I71N probably benign Het
Cdk12 A T 11: 98,221,102 I729F unknown Het
Celf1 T G 2: 91,001,078 V84G probably damaging Het
Cgn G T 3: 94,764,529 A965E probably benign Het
Cgnl1 T C 9: 71,725,322 E249G probably benign Het
Cyp2j8 T C 4: 96,470,539 N381S possibly damaging Het
Dmtf1 T C 5: 9,129,169 D343G probably damaging Het
Fhl5 T A 4: 25,214,730 I16F probably benign Het
Gatd1 A G 7: 141,409,868 F143S probably damaging Het
Gbp10 C T 5: 105,221,101 G291R probably benign Het
Gm28168 T C 1: 117,948,090 Y150H probably benign Het
Gm3543 T C 14: 41,980,165 M121V probably benign Het
Gramd3 A G 18: 56,485,379 T220A probably benign Het
Gstcd A G 3: 133,072,102 L316P probably damaging Het
Hspg2 G A 4: 137,555,221 G3424D probably benign Het
Ifi209 C T 1: 173,641,156 S184F probably benign Het
Ino80 A T 2: 119,456,467 probably null Het
Kcnd3 G A 3: 105,458,994 R60H probably damaging Het
Kif21b T C 1: 136,171,173 C1400R probably damaging Het
Lama3 C T 18: 12,537,739 P794L probably damaging Het
Lgals4 A G 7: 28,840,921 I214V probably benign Het
Lipo4 A T 19: 33,512,628 L158Q probably damaging Het
Ltv1 A G 10: 13,190,709 Y58H probably damaging Het
Mitf T C 6: 98,018,029 S479P probably benign Het
Mthfr A T 4: 148,043,463 D132V probably damaging Het
Mtrr T C 13: 68,579,547 probably null Het
Neb T A 2: 52,160,666 H6660L probably benign Het
Nhlrc3 A T 3: 53,453,545 V263E probably damaging Het
Olfr1234 C T 2: 89,363,069 R120H probably benign Het
Olfr165 T A 16: 19,407,551 D155V probably damaging Het
Olfr519 A T 7: 108,893,812 Y203* probably null Het
Pappa A T 4: 65,294,468 D1121V probably damaging Het
Pax5 A G 4: 44,537,465 S352P probably damaging Het
Piezo1 C A 8: 122,495,765 R915L Het
R3hcc1 T C 14: 69,707,144 D7G probably damaging Het
Rasgrp2 A G 19: 6,408,559 K429E probably damaging Het
Scn10a A G 9: 119,672,220 F166S probably benign Het
Scn9a T G 2: 66,484,253 N1707T probably damaging Het
Sec23ip T C 7: 128,762,477 F493S probably damaging Het
Slc1a7 G A 4: 108,012,276 V513M probably benign Het
Slfn4 A T 11: 83,187,156 I257F possibly damaging Het
Smarcal1 T A 1: 72,612,991 D637E probably benign Het
Smpd3 A C 8: 106,255,622 C617G probably benign Het
Sos2 A T 12: 69,593,040 F990L probably benign Het
Syne1 T C 10: 5,031,786 T844A probably benign Het
Tph1 G A 7: 46,657,254 R145C probably damaging Het
Ubap2l G A 3: 90,038,769 probably null Het
Vmn2r50 T C 7: 10,037,345 I810V probably benign Het
Vmn2r59 T C 7: 42,043,775 D467G probably damaging Het
Zfp618 T A 4: 63,131,115 N417K possibly damaging Het
Other mutations in Oas1h
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01676:Oas1h APN 5 120871834 missense probably damaging 1.00
IGL01890:Oas1h APN 5 120862789 splice site probably null
IGL02745:Oas1h APN 5 120861479 missense probably benign 0.04
IGL02888:Oas1h APN 5 120861547 missense probably benign 0.34
IGL02970:Oas1h APN 5 120861635 missense possibly damaging 0.91
R0125:Oas1h UTSW 5 120862563 nonsense probably null
R1261:Oas1h UTSW 5 120871867 missense probably benign 0.01
R1506:Oas1h UTSW 5 120871888 missense possibly damaging 0.66
R1565:Oas1h UTSW 5 120862600 missense probably damaging 0.97
R1696:Oas1h UTSW 5 120862822 critical splice donor site probably null
R1750:Oas1h UTSW 5 120871777 splice site probably null
R3116:Oas1h UTSW 5 120861616 nonsense probably null
R4814:Oas1h UTSW 5 120862665 missense probably damaging 0.99
R4906:Oas1h UTSW 5 120867109 nonsense probably null
R4944:Oas1h UTSW 5 120862783 missense probably damaging 1.00
R4961:Oas1h UTSW 5 120871096 missense probably damaging 1.00
R5160:Oas1h UTSW 5 120871082 missense probably damaging 1.00
R5698:Oas1h UTSW 5 120870982 missense probably damaging 1.00
R5903:Oas1h UTSW 5 120870977 missense probably damaging 1.00
R6014:Oas1h UTSW 5 120867166 missense possibly damaging 0.68
R7062:Oas1h UTSW 5 120861465 unclassified probably benign
R7966:Oas1h UTSW 5 120871899 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- AGGATCCCTCTAGTCTTGCTG -3'
(R):5'- TTGCCTTCACAGAAGTGTAAAGAC -3'

Sequencing Primer
(F):5'- GGATCCCTCTAGTCTTGCTGTATGC -3'
(R):5'- CCTTAGCAAAAGATCAAGTCTCGGTG -3'
Posted On2020-09-15