Incidental Mutation 'R7975:Sos2'
ID650862
Institutional Source Beutler Lab
Gene Symbol Sos2
Ensembl Gene ENSMUSG00000034801
Gene NameSOS Ras/Rho guanine nucleotide exchange factor 2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7975 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location69583762-69681852 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 69593040 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 990 (F990L)
Ref Sequence ENSEMBL: ENSMUSP00000138793 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035773] [ENSMUST00000182396] [ENSMUST00000183277]
PDB Structure
ORIENTATION OF PEPTIDE FRAGMENTS FROM SOS PROTEINS BOUND TO THE N-TERMINAL SH3 DOMAIN OF GRB2 DETERMINED BY NMR SPECTROSCOPY [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000035773
AA Change: F989L

PolyPhen 2 Score 0.105 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000044866
Gene: ENSMUSG00000034801
AA Change: F989L

DomainStartEndE-ValueType
Pfam:Histone 54 169 3.7e-13 PFAM
RhoGEF 203 388 1.98e-35 SMART
PH 443 547 1.54e-14 SMART
RasGEFN 595 740 5.8e-52 SMART
RasGEF 775 1019 2.51e-92 SMART
low complexity region 1079 1099 N/A INTRINSIC
low complexity region 1144 1152 N/A INTRINSIC
low complexity region 1173 1192 N/A INTRINSIC
low complexity region 1200 1225 N/A INTRINSIC
low complexity region 1254 1269 N/A INTRINSIC
low complexity region 1276 1292 N/A INTRINSIC
low complexity region 1301 1309 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000182396
AA Change: F957L

PolyPhen 2 Score 0.916 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000138589
Gene: ENSMUSG00000034801
AA Change: F957L

DomainStartEndE-ValueType
Pfam:Histone 97 169 1e-9 PFAM
Pfam:RhoGEF 203 344 1.6e-12 PFAM
PH 410 514 1.54e-14 SMART
RasGEFN 562 707 5.8e-52 SMART
RasGEF 742 986 2.51e-92 SMART
low complexity region 1046 1066 N/A INTRINSIC
low complexity region 1111 1119 N/A INTRINSIC
low complexity region 1140 1159 N/A INTRINSIC
low complexity region 1167 1192 N/A INTRINSIC
low complexity region 1221 1236 N/A INTRINSIC
low complexity region 1243 1259 N/A INTRINSIC
low complexity region 1268 1276 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000183277
AA Change: F990L

PolyPhen 2 Score 0.197 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000138793
Gene: ENSMUSG00000034801
AA Change: F990L

DomainStartEndE-ValueType
Pfam:Histone 97 169 8.9e-11 PFAM
RhoGEF 203 388 1.98e-35 SMART
PH 443 547 1.54e-14 SMART
RasGEFN 595 740 5.8e-52 SMART
RasGEF 775 1019 2.51e-92 SMART
low complexity region 1079 1099 N/A INTRINSIC
low complexity region 1144 1152 N/A INTRINSIC
low complexity region 1173 1192 N/A INTRINSIC
low complexity region 1200 1225 N/A INTRINSIC
low complexity region 1254 1269 N/A INTRINSIC
low complexity region 1276 1292 N/A INTRINSIC
low complexity region 1301 1309 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a regulatory protein that is involved in the positive regulation of ras proteins. Mutations in this gene are associated with Noonan Syndrome-9. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for a targeted null mutation exhibit no discernable phenotype; mice are viable and fertile with normal embryonic and adult histopathology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik C T 10: 82,283,989 A4396T possibly damaging Het
Ano4 T C 10: 89,116,985 I60V possibly damaging Het
Ano5 T A 7: 51,566,538 M381K probably null Het
Aox2 T A 1: 58,309,028 I635K probably benign Het
BC067074 A G 13: 113,319,307 H629R Het
Bdp1 C T 13: 100,020,376 C2436Y probably benign Het
Bod1l T C 5: 41,816,277 R2565G possibly damaging Het
Brd2 A T 17: 34,115,450 I245N probably damaging Het
Capn9 G A 8: 124,598,776 V258M probably damaging Het
Ccar2 C G 14: 70,143,469 C324S possibly damaging Het
Cd209b A T 8: 3,925,948 I71N probably benign Het
Cdk12 A T 11: 98,221,102 I729F unknown Het
Celf1 T G 2: 91,001,078 V84G probably damaging Het
Cgn G T 3: 94,764,529 A965E probably benign Het
Cgnl1 T C 9: 71,725,322 E249G probably benign Het
Cyp2j8 T C 4: 96,470,539 N381S possibly damaging Het
Dmtf1 T C 5: 9,129,169 D343G probably damaging Het
Fhl5 T A 4: 25,214,730 I16F probably benign Het
Gatd1 A G 7: 141,409,868 F143S probably damaging Het
Gbp10 C T 5: 105,221,101 G291R probably benign Het
Gm28168 T C 1: 117,948,090 Y150H probably benign Het
Gm3543 T C 14: 41,980,165 M121V probably benign Het
Gramd3 A G 18: 56,485,379 T220A probably benign Het
Gstcd A G 3: 133,072,102 L316P probably damaging Het
Hspg2 G A 4: 137,555,221 G3424D probably benign Het
Ifi209 C T 1: 173,641,156 S184F probably benign Het
Kcnd3 G A 3: 105,458,994 R60H probably damaging Het
Kif21b T C 1: 136,171,173 C1400R probably damaging Het
Lama3 C T 18: 12,537,739 P794L probably damaging Het
Lgals4 A G 7: 28,840,921 I214V probably benign Het
Lipo4 A T 19: 33,512,628 L158Q probably damaging Het
Ltv1 A G 10: 13,190,709 Y58H probably damaging Het
Mitf T C 6: 98,018,029 S479P probably benign Het
Mthfr A T 4: 148,043,463 D132V probably damaging Het
Neb T A 2: 52,160,666 H6660L probably benign Het
Nhlrc3 A T 3: 53,453,545 V263E probably damaging Het
Oas1h G A 5: 120,871,827 V322M probably damaging Het
Olfr1234 C T 2: 89,363,069 R120H probably benign Het
Olfr165 T A 16: 19,407,551 D155V probably damaging Het
Olfr519 A T 7: 108,893,812 Y203* probably null Het
Pappa A T 4: 65,294,468 D1121V probably damaging Het
Pax5 A G 4: 44,537,465 S352P probably damaging Het
Piezo1 C A 8: 122,495,765 R915L Het
R3hcc1 T C 14: 69,707,144 D7G probably damaging Het
Rasgrp2 A G 19: 6,408,559 K429E probably damaging Het
Scn10a A G 9: 119,672,220 F166S probably benign Het
Scn9a T G 2: 66,484,253 N1707T probably damaging Het
Sec23ip T C 7: 128,762,477 F493S probably damaging Het
Slc1a7 G A 4: 108,012,276 V513M probably benign Het
Slfn4 A T 11: 83,187,156 I257F possibly damaging Het
Smarcal1 T A 1: 72,612,991 D637E probably benign Het
Smpd3 A C 8: 106,255,622 C617G probably benign Het
Syne1 T C 10: 5,031,786 T844A probably benign Het
Tph1 G A 7: 46,657,254 R145C probably damaging Het
Vmn2r50 T C 7: 10,037,345 I810V probably benign Het
Vmn2r59 T C 7: 42,043,775 D467G probably damaging Het
Zfp618 T A 4: 63,131,115 N417K possibly damaging Het
Other mutations in Sos2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01138:Sos2 APN 12 69616849 splice site probably benign
IGL01348:Sos2 APN 12 69618092 missense probably damaging 0.99
IGL01360:Sos2 APN 12 69590800 missense probably benign 0.00
IGL01586:Sos2 APN 12 69607398 missense probably damaging 1.00
IGL01721:Sos2 APN 12 69603867 missense probably damaging 0.99
IGL02024:Sos2 APN 12 69618048 splice site probably benign
IGL02347:Sos2 APN 12 69596746 missense probably benign
IGL02419:Sos2 APN 12 69616990 missense probably benign
IGL02684:Sos2 APN 12 69596666 missense probably damaging 1.00
IGL02719:Sos2 APN 12 69617184 missense probably benign 0.00
IGL03099:Sos2 APN 12 69616359 missense probably damaging 1.00
Bechamel UTSW 12 69603553 missense probably damaging 1.00
sauce UTSW 12 69596795 missense probably damaging 1.00
PIT4131001:Sos2 UTSW 12 69618077 missense probably benign
R0038:Sos2 UTSW 12 69596693 missense probably damaging 1.00
R0233:Sos2 UTSW 12 69617330 missense probably benign 0.00
R0233:Sos2 UTSW 12 69617330 missense probably benign 0.00
R0326:Sos2 UTSW 12 69635685 missense probably damaging 1.00
R1386:Sos2 UTSW 12 69614658 missense probably damaging 1.00
R1472:Sos2 UTSW 12 69585316 splice site probably null
R1534:Sos2 UTSW 12 69616955 missense probably damaging 1.00
R1861:Sos2 UTSW 12 69617363 missense probably damaging 1.00
R1934:Sos2 UTSW 12 69648541 missense probably damaging 0.99
R1964:Sos2 UTSW 12 69616862 missense possibly damaging 0.51
R2402:Sos2 UTSW 12 69596799 missense possibly damaging 0.95
R2516:Sos2 UTSW 12 69650659 missense probably damaging 0.99
R2571:Sos2 UTSW 12 69635718 missense possibly damaging 0.95
R3423:Sos2 UTSW 12 69603553 missense probably damaging 1.00
R4435:Sos2 UTSW 12 69614699 missense possibly damaging 0.79
R4508:Sos2 UTSW 12 69635661 nonsense probably null
R4595:Sos2 UTSW 12 69616889 missense probably damaging 1.00
R4606:Sos2 UTSW 12 69614606 intron probably benign
R4691:Sos2 UTSW 12 69616328 missense probably damaging 1.00
R4716:Sos2 UTSW 12 69607371 missense probably benign 0.04
R4863:Sos2 UTSW 12 69640154 missense probably benign 0.04
R5179:Sos2 UTSW 12 69650728 nonsense probably null
R5319:Sos2 UTSW 12 69627284 missense probably benign 0.22
R5694:Sos2 UTSW 12 69590915 missense probably damaging 0.96
R5877:Sos2 UTSW 12 69596795 missense probably damaging 1.00
R6363:Sos2 UTSW 12 69632111 missense probably benign 0.00
R6465:Sos2 UTSW 12 69596775 missense probably benign 0.01
R6817:Sos2 UTSW 12 69618161 missense probably benign 0.32
R6822:Sos2 UTSW 12 69650649 missense probably damaging 1.00
R7015:Sos2 UTSW 12 69585235 missense probably benign 0.43
R7562:Sos2 UTSW 12 69635638 missense probably benign 0.12
R7570:Sos2 UTSW 12 69590880 missense probably damaging 1.00
R7757:Sos2 UTSW 12 69648585 missense probably damaging 0.99
R8079:Sos2 UTSW 12 69607215 missense probably damaging 1.00
R8194:Sos2 UTSW 12 69598824 missense probably damaging 1.00
Z1177:Sos2 UTSW 12 69585592 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAAGACAGCTATTGGTGATACAAC -3'
(R):5'- TCCTAATAAACTATGAGGCTAGGATGC -3'

Sequencing Primer
(F):5'- CATTACAGATGGTTATGGGCCACC -3'
(R):5'- TGCTGTCCTAGTCACAAATAGAGAGC -3'
Posted On2020-09-15