Incidental Mutation 'R7976:Lamc1'
ID 650876
Institutional Source Beutler Lab
Gene Symbol Lamc1
Ensembl Gene ENSMUSG00000026478
Gene Name laminin, gamma 1
Synonyms laminin B2, Lamb2
MMRRC Submission 046019-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R7976 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 153094668-153208532 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 153123014 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 725 (N725K)
Ref Sequence ENSEMBL: ENSMUSP00000027752 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027752]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000027752
AA Change: N725K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000027752
Gene: ENSMUSG00000026478
AA Change: N725K

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
LamNT 42 282 1.97e-150 SMART
EGF_Lam 284 337 7.18e-7 SMART
EGF_Lam 340 393 7.93e-9 SMART
EGF_Lam 396 440 2.11e-13 SMART
EGF_Lam 443 490 2.87e-15 SMART
LamB 551 676 5.52e-48 SMART
Pfam:Laminin_EGF 683 718 1.3e-4 PFAM
EGF_Lam 722 768 2.38e-12 SMART
EGF_Lam 771 823 1.39e-4 SMART
EGF_Lam 826 879 8.05e-10 SMART
EGF_Lam 882 930 8.9e-12 SMART
EGF_Lam 933 978 1.26e-11 SMART
EGF_Lam 981 1026 7.4e-9 SMART
coiled coil region 1063 1594 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Laminins, a family of extracellular matrix glycoproteins, are the major noncollagenous constituent of basement membranes. They have been implicated in a wide variety of biological processes including cell adhesion, differentiation, migration, signaling, neurite outgrowth and metastasis. Laminins, composed of 3 non identical chains: laminin alpha, beta and gamma (formerly A, B1, and B2, respectively), have a cruciform structure consisting of 3 short arms, each formed by a different chain, and a long arm composed of all 3 chains. Each laminin chain is a multidomain protein encoded by a distinct gene. Several isoforms of each chain have been described. Different alpha, beta and gamma chain isomers combine to give rise to different heterotrimeric laminin isoforms which are designated by Arabic numerals in the order of their discovery, i.e. alpha1beta1gamma1 heterotrimer is laminin 1. The biological functions of the different chains and trimer molecules are largely unknown, but some of the chains have been shown to differ with respect to their tissue distribution, presumably reflecting diverse functions in vivo. This gene encodes the gamma chain isoform laminin, gamma 1. The gamma 1 chain, formerly thought to be a beta chain, contains structural domains similar to beta chains, however, lacks the short alpha region separating domains I and II. The structural organization of this gene also suggested that it had diverged considerably from the beta chain genes. Embryos of transgenic mice in which both alleles of the gamma 1 chain gene were inactivated by homologous recombination, lacked basement membranes, indicating that laminin, gamma 1 chain is necessary for laminin heterotrimer assembly. It has been inferred by analogy with the strikingly similar 3' UTR sequence in mouse laminin gamma 1 cDNA, that multiple polyadenylation sites are utilized in human to generate the 2 different sized mRNAs (5.5 and 7.5 kb) seen on Northern analysis. [provided by RefSeq, Aug 2011]
PHENOTYPE: Embryos homozygous for a targeted null mutation lack development of basement membranes, migration of primitive endoderm cells out of the inner cell mass, and parietal yolk sac development, resulting in lethality by embryonic day 5.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adss1 A C 12: 112,602,831 (GRCm39) I341L probably benign Het
Aldh1b1 T A 4: 45,803,092 (GRCm39) M210K possibly damaging Het
Ankrd17 G A 5: 90,431,451 (GRCm39) Q778* probably null Het
Bmper T C 9: 23,318,106 (GRCm39) V575A probably damaging Het
Brinp2 A G 1: 158,073,913 (GRCm39) V736A probably benign Het
Ccdc81 A T 7: 89,515,723 (GRCm39) L652* probably null Het
Cdt1 C T 8: 123,298,585 (GRCm39) R437W probably damaging Het
Ckb A C 12: 111,637,466 (GRCm39) L165R possibly damaging Het
Col25a1 G T 3: 130,290,075 (GRCm39) G255V probably damaging Het
Ddx17 A G 15: 79,420,156 (GRCm39) probably null Het
Dennd4a G T 9: 64,759,794 (GRCm39) G300W possibly damaging Het
Dlg4 T A 11: 69,930,008 (GRCm39) I316N probably damaging Het
Dlgap2 C T 8: 14,793,410 (GRCm39) P467L probably benign Het
Dnah9 T C 11: 65,732,227 (GRCm39) I4226M possibly damaging Het
Drc1 G A 5: 30,521,829 (GRCm39) A734T probably benign Het
Entpd1 A G 19: 40,600,865 (GRCm39) M1V probably null Het
Exph5 T G 9: 53,287,935 (GRCm39) I1672S possibly damaging Het
Fam149b T A 14: 20,427,852 (GRCm39) D379E probably damaging Het
Fgfr2 T C 7: 129,787,074 (GRCm39) T461A probably damaging Het
Frem1 A G 4: 82,919,946 (GRCm39) V469A probably damaging Het
Frem3 A T 8: 81,338,231 (GRCm39) K175* probably null Het
Fsd2 C T 7: 81,209,629 (GRCm39) G71E probably benign Het
Gcat T C 15: 78,919,188 (GRCm39) I116T probably damaging Het
Gigyf2 G A 1: 87,331,458 (GRCm39) S202N unknown Het
Glra3 T G 8: 56,565,911 (GRCm39) probably null Het
Golga4 C T 9: 118,365,836 (GRCm39) T296I possibly damaging Het
Herc1 C T 9: 66,341,552 (GRCm39) T1816I possibly damaging Het
Igfbpl1 C A 4: 45,826,786 (GRCm39) R3L unknown Het
Ighv15-2 A T 12: 114,528,470 (GRCm39) S28T probably benign Het
Kat2b T A 17: 53,955,835 (GRCm39) M427K probably benign Het
Kdm4c A G 4: 74,295,906 (GRCm39) T882A probably damaging Het
Kif1a G T 1: 92,967,496 (GRCm39) F1138L probably damaging Het
Klhl20 A T 1: 160,934,307 (GRCm39) S237R probably benign Het
Lmtk3 A G 7: 45,444,890 (GRCm39) D1191G unknown Het
Ltbp1 C A 17: 75,670,358 (GRCm39) N1466K possibly damaging Het
Ly75 T C 2: 60,195,432 (GRCm39) E242G probably damaging Het
Lyrm1 T C 7: 119,515,449 (GRCm39) V113A probably benign Het
Mfsd13a G T 19: 46,360,446 (GRCm39) A333S probably benign Het
Mllt10 T C 2: 18,167,214 (GRCm39) S380P possibly damaging Het
Mrc2 A G 11: 105,238,829 (GRCm39) K1295E possibly damaging Het
Muc5ac A T 7: 141,363,528 (GRCm39) I2280F unknown Het
Neurod2 A C 11: 98,218,023 (GRCm39) F380L probably damaging Het
Ntrk3 G A 7: 78,005,954 (GRCm39) A469V probably damaging Het
Nup205 T C 6: 35,175,888 (GRCm39) F584L probably damaging Het
Oas1d A T 5: 121,057,210 (GRCm39) Y272F probably damaging Het
Olfm3 T C 3: 114,874,794 (GRCm39) V30A probably benign Het
Or4c110 T A 2: 88,831,973 (GRCm39) I220F probably damaging Het
Or5b117 A G 19: 13,431,563 (GRCm39) I106T probably benign Het
Or8k22 A G 2: 86,163,064 (GRCm39) V212A probably benign Het
Pcdhga12 A G 18: 37,901,427 (GRCm39) Y753C probably damaging Het
Phox2b A G 5: 67,253,514 (GRCm39) V294A unknown Het
Prdm2 A T 4: 142,859,812 (GRCm39) C1159* probably null Het
Ptpn12 G T 5: 21,207,631 (GRCm39) S275* probably null Het
Rigi T C 4: 40,209,894 (GRCm39) M725V probably damaging Het
Rnf223 A T 4: 156,216,776 (GRCm39) E50D probably damaging Het
Rrp12 A T 19: 41,879,548 (GRCm39) Y169N probably benign Het
Sgip1 T C 4: 102,757,736 (GRCm39) probably null Het
Shank2 T C 7: 143,964,798 (GRCm39) I802T probably damaging Het
Skint2 A T 4: 112,481,329 (GRCm39) N64I probably damaging Het
Smpd3 A C 8: 106,982,254 (GRCm39) C617G probably benign Het
Tmem106c G C 15: 97,865,985 (GRCm39) G192R probably damaging Het
Tmem72 T C 6: 116,673,800 (GRCm39) H106R probably damaging Het
Upf2 G C 2: 6,030,926 (GRCm39) V789L unknown Het
Vash1 A G 12: 86,726,758 (GRCm39) probably benign Het
Vmn1r201 T A 13: 22,658,875 (GRCm39) Y30N probably benign Het
Xpr1 A G 1: 155,166,035 (GRCm39) F571L possibly damaging Het
Yif1a T C 19: 5,139,815 (GRCm39) S87P probably damaging Het
Zer1 T C 2: 29,997,520 (GRCm39) Y462C probably damaging Het
Zfp597 G A 16: 3,684,375 (GRCm39) P127L possibly damaging Het
Zxdc T C 6: 90,375,749 (GRCm39) S742P probably benign Het
Other mutations in Lamc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00950:Lamc1 APN 1 153,116,241 (GRCm39) missense probably damaging 1.00
IGL01397:Lamc1 APN 1 153,126,880 (GRCm39) missense probably damaging 1.00
IGL01661:Lamc1 APN 1 153,097,319 (GRCm39) missense possibly damaging 0.89
IGL01894:Lamc1 APN 1 153,122,828 (GRCm39) missense possibly damaging 0.51
IGL02000:Lamc1 APN 1 153,116,179 (GRCm39) missense probably damaging 1.00
IGL02649:Lamc1 APN 1 153,122,788 (GRCm39) missense possibly damaging 0.78
IGL02749:Lamc1 APN 1 153,125,599 (GRCm39) missense possibly damaging 0.51
IGL02819:Lamc1 APN 1 153,126,407 (GRCm39) missense probably damaging 1.00
IGL02831:Lamc1 APN 1 153,122,801 (GRCm39) missense probably benign 0.00
IGL03069:Lamc1 APN 1 153,115,127 (GRCm39) missense probably damaging 1.00
IGL03143:Lamc1 APN 1 153,208,020 (GRCm39) missense probably benign 0.00
IGL03166:Lamc1 APN 1 153,208,047 (GRCm39) missense probably benign 0.01
IGL03285:Lamc1 APN 1 153,103,431 (GRCm39) missense possibly damaging 0.96
IGL03294:Lamc1 APN 1 153,138,392 (GRCm39) missense probably damaging 1.00
pride UTSW 1 153,123,030 (GRCm39) missense probably benign 0.01
Stratum UTSW 1 153,126,870 (GRCm39) nonsense probably null
tier UTSW 1 153,126,268 (GRCm39) missense probably damaging 1.00
PIT4280001:Lamc1 UTSW 1 153,119,217 (GRCm39) missense probably damaging 1.00
R0003:Lamc1 UTSW 1 153,138,185 (GRCm39) missense probably damaging 0.99
R0003:Lamc1 UTSW 1 153,138,185 (GRCm39) missense probably damaging 0.99
R0027:Lamc1 UTSW 1 153,138,329 (GRCm39) missense probably damaging 1.00
R0060:Lamc1 UTSW 1 153,117,614 (GRCm39) unclassified probably benign
R0078:Lamc1 UTSW 1 153,104,936 (GRCm39) missense probably damaging 0.96
R0157:Lamc1 UTSW 1 153,138,353 (GRCm39) missense probably benign 0.00
R0282:Lamc1 UTSW 1 153,131,058 (GRCm39) missense probably benign
R0374:Lamc1 UTSW 1 153,126,811 (GRCm39) splice site probably benign
R0494:Lamc1 UTSW 1 153,122,682 (GRCm39) critical splice donor site probably null
R0502:Lamc1 UTSW 1 153,122,678 (GRCm39) splice site probably benign
R0755:Lamc1 UTSW 1 153,123,196 (GRCm39) missense possibly damaging 0.94
R0791:Lamc1 UTSW 1 153,110,341 (GRCm39) missense probably damaging 1.00
R0791:Lamc1 UTSW 1 153,110,326 (GRCm39) missense possibly damaging 0.94
R0791:Lamc1 UTSW 1 153,110,358 (GRCm39) missense probably benign 0.01
R0792:Lamc1 UTSW 1 153,110,326 (GRCm39) missense possibly damaging 0.94
R0792:Lamc1 UTSW 1 153,110,341 (GRCm39) missense probably damaging 1.00
R0792:Lamc1 UTSW 1 153,110,358 (GRCm39) missense probably benign 0.01
R0892:Lamc1 UTSW 1 153,208,000 (GRCm39) missense possibly damaging 0.95
R0941:Lamc1 UTSW 1 153,208,020 (GRCm39) missense possibly damaging 0.72
R0961:Lamc1 UTSW 1 153,097,446 (GRCm39) missense probably benign 0.03
R0961:Lamc1 UTSW 1 153,097,392 (GRCm39) frame shift probably null
R0963:Lamc1 UTSW 1 153,119,132 (GRCm39) missense probably benign
R1127:Lamc1 UTSW 1 153,126,205 (GRCm39) missense possibly damaging 0.69
R1173:Lamc1 UTSW 1 153,122,977 (GRCm39) splice site probably benign
R1175:Lamc1 UTSW 1 153,122,977 (GRCm39) splice site probably benign
R1449:Lamc1 UTSW 1 153,126,241 (GRCm39) missense probably benign
R1481:Lamc1 UTSW 1 153,097,380 (GRCm39) missense probably damaging 1.00
R1565:Lamc1 UTSW 1 153,118,489 (GRCm39) missense probably benign 0.34
R1583:Lamc1 UTSW 1 153,119,224 (GRCm39) critical splice acceptor site probably null
R1643:Lamc1 UTSW 1 153,133,818 (GRCm39) splice site probably benign
R1652:Lamc1 UTSW 1 153,125,392 (GRCm39) missense probably damaging 1.00
R1691:Lamc1 UTSW 1 153,122,995 (GRCm39) missense probably benign 0.04
R1854:Lamc1 UTSW 1 153,125,618 (GRCm39) missense probably damaging 0.99
R2018:Lamc1 UTSW 1 153,118,378 (GRCm39) missense probably benign 0.07
R2170:Lamc1 UTSW 1 153,124,888 (GRCm39) missense probably benign 0.07
R2410:Lamc1 UTSW 1 153,123,141 (GRCm39) missense possibly damaging 0.61
R3438:Lamc1 UTSW 1 153,102,161 (GRCm39) missense probably benign 0.04
R3615:Lamc1 UTSW 1 153,126,896 (GRCm39) missense probably damaging 1.00
R3616:Lamc1 UTSW 1 153,126,896 (GRCm39) missense probably damaging 1.00
R3699:Lamc1 UTSW 1 153,130,951 (GRCm39) missense possibly damaging 0.79
R3811:Lamc1 UTSW 1 153,138,454 (GRCm39) splice site probably null
R4285:Lamc1 UTSW 1 153,110,298 (GRCm39) missense probably damaging 0.99
R4431:Lamc1 UTSW 1 153,097,274 (GRCm39) missense probably damaging 1.00
R4579:Lamc1 UTSW 1 153,123,015 (GRCm39) missense probably damaging 1.00
R4625:Lamc1 UTSW 1 153,118,442 (GRCm39) missense probably benign 0.04
R4649:Lamc1 UTSW 1 153,104,523 (GRCm39) missense probably damaging 0.99
R4650:Lamc1 UTSW 1 153,104,523 (GRCm39) missense probably damaging 0.99
R4651:Lamc1 UTSW 1 153,104,523 (GRCm39) missense probably damaging 0.99
R4652:Lamc1 UTSW 1 153,104,523 (GRCm39) missense probably damaging 0.99
R4653:Lamc1 UTSW 1 153,104,523 (GRCm39) missense probably damaging 0.99
R4784:Lamc1 UTSW 1 153,107,486 (GRCm39) missense probably damaging 1.00
R4785:Lamc1 UTSW 1 153,107,486 (GRCm39) missense probably damaging 1.00
R4853:Lamc1 UTSW 1 153,104,846 (GRCm39) missense possibly damaging 0.89
R5216:Lamc1 UTSW 1 153,103,442 (GRCm39) missense probably damaging 1.00
R5217:Lamc1 UTSW 1 153,103,442 (GRCm39) missense probably damaging 1.00
R5218:Lamc1 UTSW 1 153,103,442 (GRCm39) missense probably damaging 1.00
R5219:Lamc1 UTSW 1 153,103,442 (GRCm39) missense probably damaging 1.00
R5468:Lamc1 UTSW 1 153,109,310 (GRCm39) missense probably damaging 0.99
R5597:Lamc1 UTSW 1 153,127,716 (GRCm39) missense probably damaging 1.00
R5754:Lamc1 UTSW 1 153,123,030 (GRCm39) missense probably benign 0.01
R6233:Lamc1 UTSW 1 153,099,412 (GRCm39) missense probably benign
R6431:Lamc1 UTSW 1 153,097,417 (GRCm39) missense probably benign 0.21
R6636:Lamc1 UTSW 1 153,117,721 (GRCm39) missense possibly damaging 0.93
R6888:Lamc1 UTSW 1 153,138,238 (GRCm39) missense probably damaging 1.00
R7161:Lamc1 UTSW 1 153,102,200 (GRCm39) missense probably damaging 1.00
R7240:Lamc1 UTSW 1 153,110,396 (GRCm39) missense possibly damaging 0.82
R7388:Lamc1 UTSW 1 153,124,822 (GRCm39) missense probably damaging 1.00
R7474:Lamc1 UTSW 1 153,208,011 (GRCm39) missense possibly damaging 0.81
R7570:Lamc1 UTSW 1 153,119,021 (GRCm39) missense possibly damaging 0.64
R7583:Lamc1 UTSW 1 153,118,978 (GRCm39) missense possibly damaging 0.71
R7597:Lamc1 UTSW 1 153,116,200 (GRCm39) missense possibly damaging 0.94
R7635:Lamc1 UTSW 1 153,124,806 (GRCm39) missense probably damaging 1.00
R8012:Lamc1 UTSW 1 153,097,358 (GRCm39) missense probably benign 0.04
R8207:Lamc1 UTSW 1 153,126,268 (GRCm39) missense probably damaging 1.00
R8219:Lamc1 UTSW 1 153,123,073 (GRCm39) missense probably damaging 1.00
R8227:Lamc1 UTSW 1 153,099,500 (GRCm39) missense probably benign 0.04
R8315:Lamc1 UTSW 1 153,119,167 (GRCm39) missense probably benign 0.00
R8417:Lamc1 UTSW 1 153,106,515 (GRCm39) missense probably damaging 1.00
R8685:Lamc1 UTSW 1 153,109,288 (GRCm39) missense probably benign 0.31
R8827:Lamc1 UTSW 1 153,097,424 (GRCm39) missense probably damaging 1.00
R8995:Lamc1 UTSW 1 153,207,993 (GRCm39) missense probably benign 0.00
R9061:Lamc1 UTSW 1 153,126,870 (GRCm39) nonsense probably null
R9141:Lamc1 UTSW 1 153,123,196 (GRCm39) missense probably benign 0.01
R9187:Lamc1 UTSW 1 153,097,434 (GRCm39) nonsense probably null
R9206:Lamc1 UTSW 1 153,126,197 (GRCm39) missense probably damaging 1.00
R9222:Lamc1 UTSW 1 153,119,087 (GRCm39) missense probably damaging 0.96
R9297:Lamc1 UTSW 1 153,127,746 (GRCm39) missense probably damaging 1.00
R9318:Lamc1 UTSW 1 153,127,746 (GRCm39) missense probably damaging 1.00
R9377:Lamc1 UTSW 1 153,115,009 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- AGTCCCCATAGTACCCATCG -3'
(R):5'- CTGGGTACTTGGATGATGTCAC -3'

Sequencing Primer
(F):5'- ATCGCTACATTTCTCACAGTGGGG -3'
(R):5'- GATGTCACCTTGCAAAGTGC -3'
Posted On 2020-09-15