Incidental Mutation 'R7976:Xpr1'
ID 650877
Institutional Source Beutler Lab
Gene Symbol Xpr1
Ensembl Gene ENSMUSG00000026469
Gene Name xenotropic and polytropic retrovirus receptor 1
Synonyms Rmc1, suppressor of yeast G deletion, Syg1, Rmc-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.851) question?
Stock # R7976 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 155275701-155417415 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 155290289 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 571 (F571L)
Ref Sequence ENSEMBL: ENSMUSP00000027741 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027741] [ENSMUST00000111774] [ENSMUST00000111775]
AlphaFold Q9Z0U0
Predicted Effect possibly damaging
Transcript: ENSMUST00000027741
AA Change: F571L

PolyPhen 2 Score 0.619 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000027741
Gene: ENSMUSG00000026469
AA Change: F571L

DomainStartEndE-ValueType
Pfam:SPX 1 174 1.4e-33 PFAM
transmembrane domain 235 257 N/A INTRINSIC
Pfam:EXS 268 616 5.8e-96 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111774
AA Change: F571L

PolyPhen 2 Score 0.059 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000107404
Gene: ENSMUSG00000026469
AA Change: F571L

DomainStartEndE-ValueType
Pfam:SPX 1 176 1.5e-38 PFAM
transmembrane domain 235 257 N/A INTRINSIC
Pfam:EXS 267 617 2.4e-121 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111775
AA Change: F506L

PolyPhen 2 Score 0.250 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000107405
Gene: ENSMUSG00000026469
AA Change: F506L

DomainStartEndE-ValueType
Pfam:SPX 1 176 4.5e-39 PFAM
transmembrane domain 235 257 N/A INTRINSIC
Pfam:EXS 267 434 3.6e-45 PFAM
Pfam:EXS 432 552 3.6e-47 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a receptor for the xenotropic and polytropic classes of murine leukemia viruses. The encoded protein is involved in phosphate homeostasis by mediating phosphate export from the cell. Defects in this gene have been associated with idiopathic basal ganglia calcification-6. [provided by RefSeq, Jun 2016]
PHENOTYPE: Homozygotes and heterozygotes for a variant from some wild Mus stocks, including M. spretus, support replication of xenotropic murine leukemia viruses and mink cell focus-forming murine leukemia viruses that are not replicated in most laboratory strains. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adssl1 A C 12: 112,636,397 I341L probably benign Het
Aldh1b1 T A 4: 45,803,092 M210K possibly damaging Het
Ankrd17 G A 5: 90,283,592 Q778* probably null Het
Bmper T C 9: 23,406,810 V575A probably damaging Het
Brinp2 A G 1: 158,246,343 V736A probably benign Het
Ccdc81 A T 7: 89,866,515 L652* probably null Het
Cdt1 C T 8: 122,571,846 R437W probably damaging Het
Ckb A C 12: 111,671,032 L165R possibly damaging Het
Col25a1 G T 3: 130,496,426 G255V probably damaging Het
Ddx17 A G 15: 79,535,955 probably null Het
Ddx58 T C 4: 40,209,894 M725V probably damaging Het
Dennd4a G T 9: 64,852,512 G300W possibly damaging Het
Dlg4 T A 11: 70,039,182 I316N probably damaging Het
Dlgap2 C T 8: 14,743,410 P467L probably benign Het
Dnah9 T C 11: 65,841,401 I4226M possibly damaging Het
Drc1 G A 5: 30,364,485 A734T probably benign Het
Entpd1 A G 19: 40,612,421 M1V probably null Het
Exph5 T G 9: 53,376,635 I1672S possibly damaging Het
Fam149b T A 14: 20,377,784 D379E probably damaging Het
Fgfr2 T C 7: 130,185,344 T461A probably damaging Het
Frem1 A G 4: 83,001,709 V469A probably damaging Het
Frem3 A T 8: 80,611,602 K175* probably null Het
Fsd2 C T 7: 81,559,881 G71E probably benign Het
Gcat T C 15: 79,034,988 I116T probably damaging Het
Gigyf2 G A 1: 87,403,736 S202N unknown Het
Glra3 T G 8: 56,112,876 probably null Het
Golga4 C T 9: 118,536,768 T296I possibly damaging Het
Herc1 C T 9: 66,434,270 T1816I possibly damaging Het
Igfbpl1 C A 4: 45,826,786 R3L unknown Het
Ighv15-2 A T 12: 114,564,850 S28T probably benign Het
Kat2b T A 17: 53,648,807 M427K probably benign Het
Kdm4c A G 4: 74,377,669 T882A probably damaging Het
Kif1a G T 1: 93,039,774 F1138L probably damaging Het
Klhl20 A T 1: 161,106,737 S237R probably benign Het
Lamc1 A T 1: 153,247,268 N725K probably damaging Het
Lmtk3 A G 7: 45,795,466 D1191G unknown Het
Ltbp1 C A 17: 75,363,363 N1466K possibly damaging Het
Ly75 T C 2: 60,365,088 E242G probably damaging Het
Lyrm1 T C 7: 119,916,226 V113A probably benign Het
Mfsd13a G T 19: 46,372,007 A333S probably benign Het
Mllt10 T C 2: 18,162,403 S380P possibly damaging Het
Mrc2 A G 11: 105,348,003 K1295E possibly damaging Het
Muc5ac A T 7: 141,809,791 I2280F unknown Het
Neurod2 A C 11: 98,327,197 F380L probably damaging Het
Ntrk3 G A 7: 78,356,206 A469V probably damaging Het
Nup205 T C 6: 35,198,953 F584L probably damaging Het
Oas1d A T 5: 120,919,147 Y272F probably damaging Het
Olfm3 T C 3: 115,081,145 V30A probably benign Het
Olfr1054 A G 2: 86,332,720 V212A probably benign Het
Olfr1215 T A 2: 89,001,629 I220F probably damaging Het
Olfr1472 A G 19: 13,454,199 I106T probably benign Het
Pcdhga12 A G 18: 37,768,374 Y753C probably damaging Het
Phox2b A G 5: 67,096,171 V294A unknown Het
Prdm2 A T 4: 143,133,242 C1159* probably null Het
Ptpn12 G T 5: 21,002,633 S275* probably null Het
Rnf223 A T 4: 156,132,319 E50D probably damaging Het
Rrp12 A T 19: 41,891,109 Y169N probably benign Het
Sgip1 T C 4: 102,900,539 probably null Het
Shank2 T C 7: 144,411,061 I802T probably damaging Het
Skint2 A T 4: 112,624,132 N64I probably damaging Het
Smpd3 A C 8: 106,255,622 C617G probably benign Het
Tmem106c G C 15: 97,968,104 G192R probably damaging Het
Tmem72 T C 6: 116,696,839 H106R probably damaging Het
Upf2 G C 2: 6,026,115 V789L unknown Het
Vash1 A G 12: 86,679,984 probably benign Het
Vmn1r201 T A 13: 22,474,705 Y30N probably benign Het
Yif1a T C 19: 5,089,787 S87P probably damaging Het
Zer1 T C 2: 30,107,508 Y462C probably damaging Het
Zfp597 G A 16: 3,866,511 P127L possibly damaging Het
Zxdc T C 6: 90,398,767 S742P probably benign Het
Other mutations in Xpr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01970:Xpr1 APN 1 155290234 missense probably benign 0.00
IGL02657:Xpr1 APN 1 155290280 missense probably benign 0.05
IGL03077:Xpr1 APN 1 155281028 missense possibly damaging 0.58
R0019:Xpr1 UTSW 1 155332399 splice site probably benign
R0350:Xpr1 UTSW 1 155330468 missense probably damaging 1.00
R1299:Xpr1 UTSW 1 155417203 missense probably damaging 0.99
R1855:Xpr1 UTSW 1 155283256 missense probably benign
R2008:Xpr1 UTSW 1 155281029 splice site probably null
R2071:Xpr1 UTSW 1 155290280 missense probably benign 0.05
R4293:Xpr1 UTSW 1 155312796 missense possibly damaging 0.91
R4509:Xpr1 UTSW 1 155290161 intron probably benign
R5060:Xpr1 UTSW 1 155328684 critical splice acceptor site probably null
R5527:Xpr1 UTSW 1 155290235 missense probably benign
R5586:Xpr1 UTSW 1 155312863 missense probably benign
R5860:Xpr1 UTSW 1 155332122 intron probably benign
R7565:Xpr1 UTSW 1 155307742 missense probably benign
R7729:Xpr1 UTSW 1 155312872 missense probably benign
R7985:Xpr1 UTSW 1 155312895 missense possibly damaging 0.56
R8330:Xpr1 UTSW 1 155313255 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TACCTGTTGAGTCAGCATGC -3'
(R):5'- TGGTTAAAGGATTCCTGAAGCTC -3'

Sequencing Primer
(F):5'- AGCATGCTGGCCTAACACTG -3'
(R):5'- AGGATTCCTGAAGCTCATAACTG -3'
Posted On 2020-09-15