Incidental Mutation 'R7976:Ly75'
ID 650883
Institutional Source Beutler Lab
Gene Symbol Ly75
Ensembl Gene ENSMUSG00000026980
Gene Name lymphocyte antigen 75
Synonyms DEC-205, CD205
MMRRC Submission 046019-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7976 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 60122447-60213617 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 60195432 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 242 (E242G)
Ref Sequence ENSEMBL: ENSMUSP00000028362 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028362] [ENSMUST00000112533]
AlphaFold Q60767
Predicted Effect probably damaging
Transcript: ENSMUST00000028362
AA Change: E242G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000028362
Gene: ENSMUSG00000026980
AA Change: E242G

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
RICIN 33 146 2.63e-17 SMART
FN2 162 209 1.22e-23 SMART
CLECT 216 341 7.36e-32 SMART
CLECT 361 486 9.28e-29 SMART
CLECT 501 624 1.11e-17 SMART
CLECT 643 791 1.93e-26 SMART
CLECT 811 932 7.94e-2 SMART
CLECT 952 1091 5.81e-21 SMART
CLECT 1104 1222 1.04e-22 SMART
CLECT 1240 1382 3.48e-10 SMART
CLECT 1395 1513 9.59e-22 SMART
CLECT 1530 1661 7.79e-22 SMART
transmembrane domain 1670 1692 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112533
AA Change: E242G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000108152
Gene: ENSMUSG00000026980
AA Change: E242G

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
RICIN 33 146 2.63e-17 SMART
FN2 162 209 1.22e-23 SMART
CLECT 216 341 7.36e-32 SMART
CLECT 361 486 9.28e-29 SMART
CLECT 501 624 1.11e-17 SMART
CLECT 643 791 1.93e-26 SMART
CLECT 811 932 7.94e-2 SMART
CLECT 952 1091 5.81e-21 SMART
CLECT 1104 1222 1.04e-22 SMART
CLECT 1240 1382 3.48e-10 SMART
CLECT 1395 1513 9.59e-22 SMART
CLECT 1530 1661 7.79e-22 SMART
transmembrane domain 1670 1692 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele display abnormalities in CD8-positive T cell morphology and cytotoxic T cell physiology. [provided by MGI curators]
Allele List at MGI

All alleles(7) : Targeted, knock-out(1) Targeted, other(1) Gene trapped(5)

Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adss1 A C 12: 112,602,831 (GRCm39) I341L probably benign Het
Aldh1b1 T A 4: 45,803,092 (GRCm39) M210K possibly damaging Het
Ankrd17 G A 5: 90,431,451 (GRCm39) Q778* probably null Het
Bmper T C 9: 23,318,106 (GRCm39) V575A probably damaging Het
Brinp2 A G 1: 158,073,913 (GRCm39) V736A probably benign Het
Ccdc81 A T 7: 89,515,723 (GRCm39) L652* probably null Het
Cdt1 C T 8: 123,298,585 (GRCm39) R437W probably damaging Het
Ckb A C 12: 111,637,466 (GRCm39) L165R possibly damaging Het
Col25a1 G T 3: 130,290,075 (GRCm39) G255V probably damaging Het
Ddx17 A G 15: 79,420,156 (GRCm39) probably null Het
Dennd4a G T 9: 64,759,794 (GRCm39) G300W possibly damaging Het
Dlg4 T A 11: 69,930,008 (GRCm39) I316N probably damaging Het
Dlgap2 C T 8: 14,793,410 (GRCm39) P467L probably benign Het
Dnah9 T C 11: 65,732,227 (GRCm39) I4226M possibly damaging Het
Drc1 G A 5: 30,521,829 (GRCm39) A734T probably benign Het
Entpd1 A G 19: 40,600,865 (GRCm39) M1V probably null Het
Exph5 T G 9: 53,287,935 (GRCm39) I1672S possibly damaging Het
Fam149b T A 14: 20,427,852 (GRCm39) D379E probably damaging Het
Fgfr2 T C 7: 129,787,074 (GRCm39) T461A probably damaging Het
Frem1 A G 4: 82,919,946 (GRCm39) V469A probably damaging Het
Frem3 A T 8: 81,338,231 (GRCm39) K175* probably null Het
Fsd2 C T 7: 81,209,629 (GRCm39) G71E probably benign Het
Gcat T C 15: 78,919,188 (GRCm39) I116T probably damaging Het
Gigyf2 G A 1: 87,331,458 (GRCm39) S202N unknown Het
Glra3 T G 8: 56,565,911 (GRCm39) probably null Het
Golga4 C T 9: 118,365,836 (GRCm39) T296I possibly damaging Het
Herc1 C T 9: 66,341,552 (GRCm39) T1816I possibly damaging Het
Igfbpl1 C A 4: 45,826,786 (GRCm39) R3L unknown Het
Ighv15-2 A T 12: 114,528,470 (GRCm39) S28T probably benign Het
Kat2b T A 17: 53,955,835 (GRCm39) M427K probably benign Het
Kdm4c A G 4: 74,295,906 (GRCm39) T882A probably damaging Het
Kif1a G T 1: 92,967,496 (GRCm39) F1138L probably damaging Het
Klhl20 A T 1: 160,934,307 (GRCm39) S237R probably benign Het
Lamc1 A T 1: 153,123,014 (GRCm39) N725K probably damaging Het
Lmtk3 A G 7: 45,444,890 (GRCm39) D1191G unknown Het
Ltbp1 C A 17: 75,670,358 (GRCm39) N1466K possibly damaging Het
Lyrm1 T C 7: 119,515,449 (GRCm39) V113A probably benign Het
Mfsd13a G T 19: 46,360,446 (GRCm39) A333S probably benign Het
Mllt10 T C 2: 18,167,214 (GRCm39) S380P possibly damaging Het
Mrc2 A G 11: 105,238,829 (GRCm39) K1295E possibly damaging Het
Muc5ac A T 7: 141,363,528 (GRCm39) I2280F unknown Het
Neurod2 A C 11: 98,218,023 (GRCm39) F380L probably damaging Het
Ntrk3 G A 7: 78,005,954 (GRCm39) A469V probably damaging Het
Nup205 T C 6: 35,175,888 (GRCm39) F584L probably damaging Het
Oas1d A T 5: 121,057,210 (GRCm39) Y272F probably damaging Het
Olfm3 T C 3: 114,874,794 (GRCm39) V30A probably benign Het
Or4c110 T A 2: 88,831,973 (GRCm39) I220F probably damaging Het
Or5b117 A G 19: 13,431,563 (GRCm39) I106T probably benign Het
Or8k22 A G 2: 86,163,064 (GRCm39) V212A probably benign Het
Pcdhga12 A G 18: 37,901,427 (GRCm39) Y753C probably damaging Het
Phox2b A G 5: 67,253,514 (GRCm39) V294A unknown Het
Prdm2 A T 4: 142,859,812 (GRCm39) C1159* probably null Het
Ptpn12 G T 5: 21,207,631 (GRCm39) S275* probably null Het
Rigi T C 4: 40,209,894 (GRCm39) M725V probably damaging Het
Rnf223 A T 4: 156,216,776 (GRCm39) E50D probably damaging Het
Rrp12 A T 19: 41,879,548 (GRCm39) Y169N probably benign Het
Sgip1 T C 4: 102,757,736 (GRCm39) probably null Het
Shank2 T C 7: 143,964,798 (GRCm39) I802T probably damaging Het
Skint2 A T 4: 112,481,329 (GRCm39) N64I probably damaging Het
Smpd3 A C 8: 106,982,254 (GRCm39) C617G probably benign Het
Tmem106c G C 15: 97,865,985 (GRCm39) G192R probably damaging Het
Tmem72 T C 6: 116,673,800 (GRCm39) H106R probably damaging Het
Upf2 G C 2: 6,030,926 (GRCm39) V789L unknown Het
Vash1 A G 12: 86,726,758 (GRCm39) probably benign Het
Vmn1r201 T A 13: 22,658,875 (GRCm39) Y30N probably benign Het
Xpr1 A G 1: 155,166,035 (GRCm39) F571L possibly damaging Het
Yif1a T C 19: 5,139,815 (GRCm39) S87P probably damaging Het
Zer1 T C 2: 29,997,520 (GRCm39) Y462C probably damaging Het
Zfp597 G A 16: 3,684,375 (GRCm39) P127L possibly damaging Het
Zxdc T C 6: 90,375,749 (GRCm39) S742P probably benign Het
Other mutations in Ly75
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00561:Ly75 APN 2 60,206,421 (GRCm39) missense probably damaging 1.00
IGL01072:Ly75 APN 2 60,184,840 (GRCm39) missense probably damaging 1.00
IGL01409:Ly75 APN 2 60,152,036 (GRCm39) splice site probably null
IGL01432:Ly75 APN 2 60,206,351 (GRCm39) missense probably damaging 1.00
IGL01626:Ly75 APN 2 60,131,359 (GRCm39) missense probably benign 0.13
IGL01690:Ly75 APN 2 60,168,655 (GRCm39) missense probably damaging 1.00
IGL01862:Ly75 APN 2 60,129,516 (GRCm39) missense probably damaging 1.00
IGL01982:Ly75 APN 2 60,142,108 (GRCm39) missense probably damaging 1.00
IGL02075:Ly75 APN 2 60,182,700 (GRCm39) missense probably damaging 0.99
IGL02338:Ly75 APN 2 60,184,796 (GRCm39) missense probably benign 0.04
IGL02364:Ly75 APN 2 60,188,851 (GRCm39) missense probably damaging 1.00
IGL02456:Ly75 APN 2 60,124,125 (GRCm39) missense probably benign 0.09
IGL02474:Ly75 APN 2 60,213,526 (GRCm39) missense probably null 1.00
IGL02608:Ly75 APN 2 60,152,244 (GRCm39) missense probably benign 0.41
IGL02986:Ly75 APN 2 60,138,535 (GRCm39) missense probably damaging 1.00
IGL03015:Ly75 APN 2 60,206,504 (GRCm39) missense probably damaging 1.00
IGL03049:Ly75 APN 2 60,182,414 (GRCm39) missense probably damaging 0.99
euphues UTSW 2 60,129,389 (GRCm39) critical splice donor site probably null
four_score UTSW 2 60,142,115 (GRCm39) missense possibly damaging 0.75
lyly UTSW 2 60,158,217 (GRCm39) missense possibly damaging 0.49
Witty UTSW 2 60,184,844 (GRCm39) missense probably damaging 1.00
D605:Ly75 UTSW 2 60,182,696 (GRCm39) critical splice donor site probably null
R0046:Ly75 UTSW 2 60,169,801 (GRCm39) intron probably benign
R0055:Ly75 UTSW 2 60,152,262 (GRCm39) missense probably benign 0.01
R0055:Ly75 UTSW 2 60,152,262 (GRCm39) missense probably benign 0.01
R0071:Ly75 UTSW 2 60,152,163 (GRCm39) missense probably benign 0.01
R0071:Ly75 UTSW 2 60,152,163 (GRCm39) missense probably benign 0.01
R0285:Ly75 UTSW 2 60,148,663 (GRCm39) missense probably damaging 1.00
R0387:Ly75 UTSW 2 60,136,748 (GRCm39) missense probably benign 0.20
R0492:Ly75 UTSW 2 60,138,620 (GRCm39) missense probably damaging 1.00
R0688:Ly75 UTSW 2 60,146,565 (GRCm39) missense probably benign 0.41
R1367:Ly75 UTSW 2 60,124,102 (GRCm39) splice site probably null
R1463:Ly75 UTSW 2 60,199,101 (GRCm39) critical splice donor site probably null
R1581:Ly75 UTSW 2 60,158,237 (GRCm39) missense probably damaging 1.00
R1663:Ly75 UTSW 2 60,144,578 (GRCm39) missense probably damaging 1.00
R1818:Ly75 UTSW 2 60,142,121 (GRCm39) missense probably damaging 1.00
R1881:Ly75 UTSW 2 60,180,284 (GRCm39) missense probably benign 0.00
R2244:Ly75 UTSW 2 60,180,257 (GRCm39) missense probably benign 0.01
R2905:Ly75 UTSW 2 60,164,898 (GRCm39) missense probably benign 0.00
R3967:Ly75 UTSW 2 60,158,217 (GRCm39) missense possibly damaging 0.49
R3968:Ly75 UTSW 2 60,158,217 (GRCm39) missense possibly damaging 0.49
R4039:Ly75 UTSW 2 60,183,339 (GRCm39) missense probably damaging 1.00
R4406:Ly75 UTSW 2 60,184,894 (GRCm39) missense probably damaging 1.00
R4526:Ly75 UTSW 2 60,161,117 (GRCm39) missense probably benign 0.09
R4647:Ly75 UTSW 2 60,138,622 (GRCm39) missense probably damaging 1.00
R4795:Ly75 UTSW 2 60,180,284 (GRCm39) missense probably benign 0.00
R4796:Ly75 UTSW 2 60,180,284 (GRCm39) missense probably benign 0.00
R4962:Ly75 UTSW 2 60,182,469 (GRCm39) missense probably damaging 1.00
R4979:Ly75 UTSW 2 60,206,238 (GRCm39) missense probably damaging 1.00
R5072:Ly75 UTSW 2 60,206,307 (GRCm39) missense probably damaging 1.00
R5288:Ly75 UTSW 2 60,133,985 (GRCm39) missense probably damaging 1.00
R5373:Ly75 UTSW 2 60,142,115 (GRCm39) missense possibly damaging 0.75
R5374:Ly75 UTSW 2 60,142,115 (GRCm39) missense possibly damaging 0.75
R5384:Ly75 UTSW 2 60,164,831 (GRCm39) nonsense probably null
R5385:Ly75 UTSW 2 60,133,985 (GRCm39) missense probably damaging 1.00
R5395:Ly75 UTSW 2 60,195,455 (GRCm39) missense probably benign 0.41
R5531:Ly75 UTSW 2 60,195,489 (GRCm39) missense probably damaging 0.98
R5662:Ly75 UTSW 2 60,182,725 (GRCm39) missense probably damaging 1.00
R5667:Ly75 UTSW 2 60,138,655 (GRCm39) missense probably damaging 1.00
R5668:Ly75 UTSW 2 60,184,844 (GRCm39) missense probably damaging 1.00
R5671:Ly75 UTSW 2 60,138,655 (GRCm39) missense probably damaging 1.00
R5677:Ly75 UTSW 2 60,129,426 (GRCm39) missense probably benign 0.00
R5764:Ly75 UTSW 2 60,148,783 (GRCm39) missense probably benign
R5896:Ly75 UTSW 2 60,213,490 (GRCm39) missense probably benign
R6025:Ly75 UTSW 2 60,206,306 (GRCm39) missense probably damaging 1.00
R6113:Ly75 UTSW 2 60,199,217 (GRCm39) missense probably benign 0.04
R6448:Ly75 UTSW 2 60,129,389 (GRCm39) critical splice donor site probably null
R6601:Ly75 UTSW 2 60,148,720 (GRCm39) missense probably benign 0.11
R6745:Ly75 UTSW 2 60,138,523 (GRCm39) missense probably damaging 1.00
R6955:Ly75 UTSW 2 60,158,217 (GRCm39) missense possibly damaging 0.49
R6960:Ly75 UTSW 2 60,136,749 (GRCm39) missense probably benign
R7100:Ly75 UTSW 2 60,136,778 (GRCm39) missense probably benign
R7110:Ly75 UTSW 2 60,206,528 (GRCm39) missense probably benign 0.31
R7203:Ly75 UTSW 2 60,154,196 (GRCm39) nonsense probably null
R7291:Ly75 UTSW 2 60,160,337 (GRCm39) missense probably damaging 0.98
R7308:Ly75 UTSW 2 60,164,859 (GRCm39) missense probably benign 0.04
R7447:Ly75 UTSW 2 60,164,818 (GRCm39) nonsense probably null
R7512:Ly75 UTSW 2 60,164,907 (GRCm39) missense probably damaging 1.00
R7595:Ly75 UTSW 2 60,124,171 (GRCm39) missense probably benign 0.01
R8005:Ly75 UTSW 2 60,163,278 (GRCm39) missense probably damaging 1.00
R8171:Ly75 UTSW 2 60,144,572 (GRCm39) missense possibly damaging 0.51
R8392:Ly75 UTSW 2 60,180,284 (GRCm39) missense probably benign 0.00
R8705:Ly75 UTSW 2 60,148,729 (GRCm39) missense probably damaging 0.98
R8714:Ly75 UTSW 2 60,164,829 (GRCm39) missense probably damaging 1.00
R8798:Ly75 UTSW 2 60,154,270 (GRCm39) missense probably benign 0.32
R8799:Ly75 UTSW 2 60,178,785 (GRCm39) missense probably damaging 1.00
R8834:Ly75 UTSW 2 60,161,433 (GRCm39) missense probably benign
R8990:Ly75 UTSW 2 60,188,903 (GRCm39) missense probably benign 0.10
R9015:Ly75 UTSW 2 60,146,442 (GRCm39) missense probably benign
R9547:Ly75 UTSW 2 60,161,069 (GRCm39) critical splice donor site probably null
R9628:Ly75 UTSW 2 60,158,285 (GRCm39) missense probably damaging 1.00
R9659:Ly75 UTSW 2 60,168,665 (GRCm39) missense probably damaging 1.00
R9660:Ly75 UTSW 2 60,154,184 (GRCm39) missense probably damaging 1.00
R9747:Ly75 UTSW 2 60,136,672 (GRCm39) critical splice donor site probably null
X0025:Ly75 UTSW 2 60,184,819 (GRCm39) missense probably damaging 1.00
Z1177:Ly75 UTSW 2 60,182,477 (GRCm39) missense possibly damaging 0.65
Z1177:Ly75 UTSW 2 60,180,348 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCATTTCAACACATGGGATATGC -3'
(R):5'- CTTGCCATCTTGTAAGCACG -3'

Sequencing Primer
(F):5'- CAACACATGGGATATGCTTACATTC -3'
(R):5'- TCTTGTAAGCACGCCAAGTAACAG -3'
Posted On 2020-09-15