Incidental Mutation 'R7976:Frem1'
ID 650892
Institutional Source Beutler Lab
Gene Symbol Frem1
Ensembl Gene ENSMUSG00000059049
Gene Name Fras1 related extracellular matrix protein 1
Synonyms eyes2, heb, eye, crf11, QBRICK
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.824) question?
Stock # R7976 (G1)
Quality Score 225.009
Status Not validated
Chromosome 4
Chromosomal Location 82897920-83052339 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 83001709 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 469 (V469A)
Ref Sequence ENSEMBL: ENSMUSP00000071627 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071708] [ENSMUST00000107230] [ENSMUST00000170248]
AlphaFold Q684R7
Predicted Effect probably damaging
Transcript: ENSMUST00000071708
AA Change: V469A

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000071627
Gene: ENSMUSG00000059049
AA Change: V469A

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
Pfam:Cadherin_3 364 508 1.7e-37 PFAM
Pfam:Cadherin_3 509 623 3.7e-18 PFAM
Pfam:Cadherin_3 592 709 8.4e-16 PFAM
Pfam:Cadherin_3 746 894 4.8e-26 PFAM
Pfam:Cadherin_3 863 1009 2.8e-30 PFAM
Pfam:Cadherin_3 1024 1115 6.4e-13 PFAM
Pfam:Cadherin_3 1119 1252 1.4e-17 PFAM
Pfam:Cadherin_3 1243 1393 8.2e-35 PFAM
Pfam:Cadherin_3 1378 1506 2e-22 PFAM
Pfam:Cadherin_3 1506 1616 1e-29 PFAM
Pfam:Cadherin_3 1617 1744 1.5e-14 PFAM
Pfam:Calx-beta 1749 1848 2.6e-10 PFAM
low complexity region 1894 1910 N/A INTRINSIC
CLECT 2065 2188 2.25e-27 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000107230
AA Change: V469A

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000102849
Gene: ENSMUSG00000059049
AA Change: V469A

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
internal_repeat_1 296 967 9.01e-39 PROSPERO
internal_repeat_1 1026 1705 9.01e-39 PROSPERO
Pfam:Calx-beta 1730 1829 6.7e-10 PFAM
low complexity region 1875 1891 N/A INTRINSIC
CLECT 2046 2169 2.25e-27 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000170248
AA Change: V470A

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000125809
Gene: ENSMUSG00000059049
AA Change: V470A

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
Pfam:Cadherin_3 365 509 1.3e-37 PFAM
Pfam:Cadherin_3 510 623 4.5e-18 PFAM
Pfam:Cadherin_3 593 711 6.1e-16 PFAM
Pfam:Cadherin_3 728 876 2.7e-27 PFAM
Pfam:Cadherin_3 845 991 2.1e-30 PFAM
Pfam:Cadherin_3 1006 1097 4.8e-13 PFAM
Pfam:Cadherin_3 1101 1234 1e-17 PFAM
Pfam:Cadherin_3 1225 1375 6.1e-35 PFAM
Pfam:Cadherin_3 1360 1488 1.5e-22 PFAM
Pfam:Cadherin_3 1488 1598 7.5e-30 PFAM
Pfam:Cadherin_3 1599 1726 1.1e-14 PFAM
Pfam:Calx-beta 1731 1830 6.4e-10 PFAM
low complexity region 1876 1892 N/A INTRINSIC
CLECT 2047 2170 2.25e-27 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a basement membrane protein that may play a role in craniofacial and renal development. Mutations in this gene have been associated with bifid nose with or without anorectal and renal anomalies. Alternatively spliced transcript variants encoding different isoforms have been described. PubMed ID 19940113 describes one such variant that initiates transcription within a distinct, internal exon; the resulting shorter isoform (named Toll-like/interleukin-1 receptor regulator, TILRR) is suggested to be a co-receptor of the interleukin 1 receptor family and may regulate receptor function and Toll-like receptor/interleukin 1 receptor signal transduction, contributing to the control of inflammatory response activation. [provided by RefSeq, Apr 2011]
PHENOTYPE: Homozygous mutation of this gene results in subepidermal blistering, cryptophthalmos, syndactyly, and renal agenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adssl1 A C 12: 112,636,397 I341L probably benign Het
Aldh1b1 T A 4: 45,803,092 M210K possibly damaging Het
Ankrd17 G A 5: 90,283,592 Q778* probably null Het
Bmper T C 9: 23,406,810 V575A probably damaging Het
Brinp2 A G 1: 158,246,343 V736A probably benign Het
Ccdc81 A T 7: 89,866,515 L652* probably null Het
Cdt1 C T 8: 122,571,846 R437W probably damaging Het
Ckb A C 12: 111,671,032 L165R possibly damaging Het
Col25a1 G T 3: 130,496,426 G255V probably damaging Het
Ddx17 A G 15: 79,535,955 probably null Het
Ddx58 T C 4: 40,209,894 M725V probably damaging Het
Dennd4a G T 9: 64,852,512 G300W possibly damaging Het
Dlg4 T A 11: 70,039,182 I316N probably damaging Het
Dlgap2 C T 8: 14,743,410 P467L probably benign Het
Dnah9 T C 11: 65,841,401 I4226M possibly damaging Het
Drc1 G A 5: 30,364,485 A734T probably benign Het
Entpd1 A G 19: 40,612,421 M1V probably null Het
Exph5 T G 9: 53,376,635 I1672S possibly damaging Het
Fam149b T A 14: 20,377,784 D379E probably damaging Het
Fgfr2 T C 7: 130,185,344 T461A probably damaging Het
Frem3 A T 8: 80,611,602 K175* probably null Het
Fsd2 C T 7: 81,559,881 G71E probably benign Het
Gcat T C 15: 79,034,988 I116T probably damaging Het
Gigyf2 G A 1: 87,403,736 S202N unknown Het
Glra3 T G 8: 56,112,876 probably null Het
Golga4 C T 9: 118,536,768 T296I possibly damaging Het
Herc1 C T 9: 66,434,270 T1816I possibly damaging Het
Igfbpl1 C A 4: 45,826,786 R3L unknown Het
Ighv15-2 A T 12: 114,564,850 S28T probably benign Het
Kat2b T A 17: 53,648,807 M427K probably benign Het
Kdm4c A G 4: 74,377,669 T882A probably damaging Het
Kif1a G T 1: 93,039,774 F1138L probably damaging Het
Klhl20 A T 1: 161,106,737 S237R probably benign Het
Lamc1 A T 1: 153,247,268 N725K probably damaging Het
Lmtk3 A G 7: 45,795,466 D1191G unknown Het
Ltbp1 C A 17: 75,363,363 N1466K possibly damaging Het
Ly75 T C 2: 60,365,088 E242G probably damaging Het
Lyrm1 T C 7: 119,916,226 V113A probably benign Het
Mfsd13a G T 19: 46,372,007 A333S probably benign Het
Mllt10 T C 2: 18,162,403 S380P possibly damaging Het
Mrc2 A G 11: 105,348,003 K1295E possibly damaging Het
Muc5ac A T 7: 141,809,791 I2280F unknown Het
Neurod2 A C 11: 98,327,197 F380L probably damaging Het
Ntrk3 G A 7: 78,356,206 A469V probably damaging Het
Nup205 T C 6: 35,198,953 F584L probably damaging Het
Oas1d A T 5: 120,919,147 Y272F probably damaging Het
Olfm3 T C 3: 115,081,145 V30A probably benign Het
Olfr1054 A G 2: 86,332,720 V212A probably benign Het
Olfr1215 T A 2: 89,001,629 I220F probably damaging Het
Olfr1472 A G 19: 13,454,199 I106T probably benign Het
Pcdhga12 A G 18: 37,768,374 Y753C probably damaging Het
Phox2b A G 5: 67,096,171 V294A unknown Het
Prdm2 A T 4: 143,133,242 C1159* probably null Het
Ptpn12 G T 5: 21,002,633 S275* probably null Het
Rnf223 A T 4: 156,132,319 E50D probably damaging Het
Rrp12 A T 19: 41,891,109 Y169N probably benign Het
Sgip1 T C 4: 102,900,539 probably null Het
Shank2 T C 7: 144,411,061 I802T probably damaging Het
Skint2 A T 4: 112,624,132 N64I probably damaging Het
Smpd3 A C 8: 106,255,622 C617G probably benign Het
Tmem106c G C 15: 97,968,104 G192R probably damaging Het
Tmem72 T C 6: 116,696,839 H106R probably damaging Het
Upf2 G C 2: 6,026,115 V789L unknown Het
Vash1 A G 12: 86,679,984 probably benign Het
Vmn1r201 T A 13: 22,474,705 Y30N probably benign Het
Xpr1 A G 1: 155,290,289 F571L possibly damaging Het
Yif1a T C 19: 5,089,787 S87P probably damaging Het
Zer1 T C 2: 30,107,508 Y462C probably damaging Het
Zfp597 G A 16: 3,866,511 P127L possibly damaging Het
Zxdc T C 6: 90,398,767 S742P probably benign Het
Other mutations in Frem1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00155:Frem1 APN 4 82959389 missense possibly damaging 0.46
IGL01069:Frem1 APN 4 83013867 missense probably benign 0.00
IGL01106:Frem1 APN 4 82922257 missense probably benign 0.00
IGL01398:Frem1 APN 4 82950362 missense possibly damaging 0.64
IGL01617:Frem1 APN 4 82936139 missense probably benign 0.02
IGL01647:Frem1 APN 4 82950356 missense possibly damaging 0.60
IGL01690:Frem1 APN 4 82959296 splice site probably benign
IGL02006:Frem1 APN 4 82992800 critical splice donor site probably null
IGL02069:Frem1 APN 4 82903551 missense probably damaging 1.00
IGL02131:Frem1 APN 4 82924854 missense probably benign 0.03
IGL02225:Frem1 APN 4 82940506 missense probably damaging 1.00
IGL02439:Frem1 APN 4 82956345 missense probably benign 0.00
IGL02567:Frem1 APN 4 83000055 missense probably damaging 1.00
IGL02647:Frem1 APN 4 83001754 missense probably damaging 1.00
IGL02653:Frem1 APN 4 82959334 missense probably benign 0.22
IGL02831:Frem1 APN 4 82956158 missense probably benign 0.31
IGL02997:Frem1 APN 4 82934968 missense probably damaging 1.00
IGL03005:Frem1 APN 4 82994134 missense probably damaging 1.00
IGL03036:Frem1 APN 4 82959339 missense possibly damaging 0.55
IGL03193:Frem1 APN 4 82994026 splice site probably benign
IGL03218:Frem1 APN 4 82914646 missense probably benign 0.00
IGL03235:Frem1 APN 4 83020755 missense possibly damaging 0.87
IGL03243:Frem1 APN 4 83013969 missense probably damaging 1.00
bat UTSW 4 82983060 intron probably benign
blister UTSW 4 83020770 missense probably benign 0.28
R0519_frem1_373 UTSW 4 82970633 critical splice donor site probably null
R4764_Frem1_085 UTSW 4 82989189 missense probably damaging 1.00
R6165_Frem1_083 UTSW 4 82956255 missense probably benign 0.16
R6324_Frem1_643 UTSW 4 82983337 missense probably benign 0.00
PIT4131001:Frem1 UTSW 4 83005808 missense probably damaging 0.99
PIT4466001:Frem1 UTSW 4 82972137 missense probably benign 0.01
PIT4472001:Frem1 UTSW 4 82972137 missense probably benign 0.01
PIT4515001:Frem1 UTSW 4 82900426 missense probably damaging 0.98
PIT4531001:Frem1 UTSW 4 82950280 missense probably benign 0.12
R0010:Frem1 UTSW 4 83000098 missense probably benign 0.41
R0010:Frem1 UTSW 4 83000098 missense probably benign 0.41
R0115:Frem1 UTSW 4 82936169 missense possibly damaging 0.94
R0125:Frem1 UTSW 4 83011951 missense probably damaging 1.00
R0280:Frem1 UTSW 4 82969444 missense probably damaging 1.00
R0504:Frem1 UTSW 4 82912637 missense probably benign 0.26
R0519:Frem1 UTSW 4 82970633 critical splice donor site probably null
R0631:Frem1 UTSW 4 82972165 missense probably damaging 1.00
R0645:Frem1 UTSW 4 82989166 missense probably damaging 1.00
R0781:Frem1 UTSW 4 82950320 missense probably damaging 0.99
R1110:Frem1 UTSW 4 82950320 missense probably damaging 0.99
R1115:Frem1 UTSW 4 83020770 missense probably benign 0.28
R1130:Frem1 UTSW 4 82916628 splice site probably null
R1173:Frem1 UTSW 4 82950352 missense probably benign 0.16
R1349:Frem1 UTSW 4 82922305 splice site probably benign
R1464:Frem1 UTSW 4 83011879 missense probably damaging 1.00
R1464:Frem1 UTSW 4 83011879 missense probably damaging 1.00
R1658:Frem1 UTSW 4 83001808 missense probably damaging 1.00
R1672:Frem1 UTSW 4 82998891 missense probably benign 0.09
R1831:Frem1 UTSW 4 83020837 missense possibly damaging 0.95
R1851:Frem1 UTSW 4 82950500 missense probably damaging 0.98
R2014:Frem1 UTSW 4 83005852 missense probably damaging 1.00
R2021:Frem1 UTSW 4 82913558 missense probably benign 0.02
R2022:Frem1 UTSW 4 82913558 missense probably benign 0.02
R2023:Frem1 UTSW 4 82913558 missense probably benign 0.02
R2183:Frem1 UTSW 4 82991495 missense probably benign 0.00
R2437:Frem1 UTSW 4 83000173 missense probably damaging 1.00
R2520:Frem1 UTSW 4 82950290 missense probably damaging 0.99
R3195:Frem1 UTSW 4 83014114 missense probably damaging 0.99
R3196:Frem1 UTSW 4 83014114 missense probably damaging 0.99
R3408:Frem1 UTSW 4 83011986 missense probably damaging 1.00
R3411:Frem1 UTSW 4 82963179 missense possibly damaging 0.51
R3742:Frem1 UTSW 4 83011867 missense probably damaging 1.00
R3829:Frem1 UTSW 4 82998930 missense probably damaging 1.00
R3888:Frem1 UTSW 4 82913607 missense probably benign 0.41
R4329:Frem1 UTSW 4 82986537 missense probably benign 0.01
R4364:Frem1 UTSW 4 82913251 missense probably damaging 0.99
R4411:Frem1 UTSW 4 82963244 missense probably damaging 1.00
R4624:Frem1 UTSW 4 82989106 missense probably damaging 1.00
R4687:Frem1 UTSW 4 83020631 missense probably damaging 1.00
R4764:Frem1 UTSW 4 82989189 missense probably damaging 1.00
R4801:Frem1 UTSW 4 82916628 splice site probably benign
R4802:Frem1 UTSW 4 82916628 splice site probably benign
R4854:Frem1 UTSW 4 82916758 missense possibly damaging 0.88
R4872:Frem1 UTSW 4 82963150 missense probably damaging 1.00
R4947:Frem1 UTSW 4 82966134 missense probably damaging 0.99
R5007:Frem1 UTSW 4 82940812 intron probably benign
R5103:Frem1 UTSW 4 82991612 missense probably benign
R5369:Frem1 UTSW 4 83001739 missense possibly damaging 0.61
R5494:Frem1 UTSW 4 82940753 makesense probably null
R5694:Frem1 UTSW 4 82994116 missense probably damaging 1.00
R5780:Frem1 UTSW 4 82950415 missense probably benign 0.12
R5813:Frem1 UTSW 4 83000158 missense probably damaging 1.00
R5843:Frem1 UTSW 4 82936052 missense probably damaging 1.00
R5914:Frem1 UTSW 4 83001775 missense probably damaging 1.00
R5985:Frem1 UTSW 4 82966050 missense probably benign
R6091:Frem1 UTSW 4 82900559 missense probably benign 0.01
R6165:Frem1 UTSW 4 82956255 missense probably benign 0.16
R6324:Frem1 UTSW 4 82983337 missense probably benign 0.00
R6369:Frem1 UTSW 4 82913792 splice site probably null
R6414:Frem1 UTSW 4 82940536 missense probably damaging 0.98
R6421:Frem1 UTSW 4 82994128 missense probably damaging 1.00
R6434:Frem1 UTSW 4 82966016 missense probably benign 0.03
R6453:Frem1 UTSW 4 82914825 nonsense probably null
R6598:Frem1 UTSW 4 83013828 missense probably damaging 0.99
R6720:Frem1 UTSW 4 83013832 missense probably damaging 0.98
R6862:Frem1 UTSW 4 83012014 nonsense probably null
R6922:Frem1 UTSW 4 82922269 missense probably damaging 1.00
R6931:Frem1 UTSW 4 82970677 missense probably damaging 1.00
R6992:Frem1 UTSW 4 82940362 missense possibly damaging 0.62
R6995:Frem1 UTSW 4 82986601 missense probably damaging 1.00
R7001:Frem1 UTSW 4 82986561 missense probably benign 0.44
R7104:Frem1 UTSW 4 82940681 missense probably benign 0.30
R7146:Frem1 UTSW 4 82922295 missense possibly damaging 0.93
R7174:Frem1 UTSW 4 82922256 missense probably benign 0.00
R7327:Frem1 UTSW 4 83020755 missense possibly damaging 0.87
R7343:Frem1 UTSW 4 82994122 missense probably damaging 0.99
R7368:Frem1 UTSW 4 82966144 missense probably benign 0.19
R7392:Frem1 UTSW 4 83013827 missense probably benign 0.06
R7465:Frem1 UTSW 4 82914835 missense probably benign 0.11
R7499:Frem1 UTSW 4 83005770 missense probably damaging 1.00
R7536:Frem1 UTSW 4 82956195 missense probably damaging 1.00
R7752:Frem1 UTSW 4 82959377 missense probably benign 0.02
R7753:Frem1 UTSW 4 82913980 missense probably benign 0.03
R7790:Frem1 UTSW 4 82989164 missense probably benign 0.02
R7818:Frem1 UTSW 4 83014008 missense probably damaging 1.00
R7877:Frem1 UTSW 4 83013812 critical splice donor site probably null
R7878:Frem1 UTSW 4 83020680 missense probably benign 0.00
R7886:Frem1 UTSW 4 83016406 missense possibly damaging 0.68
R7901:Frem1 UTSW 4 82959377 missense probably benign 0.02
R8240:Frem1 UTSW 4 82956248 missense probably benign 0.21
R8305:Frem1 UTSW 4 82999989 missense probably benign 0.06
R8415:Frem1 UTSW 4 83000262 missense probably damaging 1.00
R8751:Frem1 UTSW 4 82970778 missense probably damaging 1.00
R8819:Frem1 UTSW 4 82903517 missense probably damaging 1.00
R8820:Frem1 UTSW 4 82903517 missense probably damaging 1.00
R8829:Frem1 UTSW 4 83000194 missense probably damaging 1.00
R8834:Frem1 UTSW 4 83004373 missense probably damaging 1.00
R8857:Frem1 UTSW 4 83004043 intron probably benign
R8910:Frem1 UTSW 4 82950457 missense probably benign 0.09
R9036:Frem1 UTSW 4 82913548 missense probably benign
R9228:Frem1 UTSW 4 83001820 missense probably damaging 1.00
R9382:Frem1 UTSW 4 82983385 missense possibly damaging 0.79
R9441:Frem1 UTSW 4 83005846 missense probably damaging 1.00
R9492:Frem1 UTSW 4 83001820 missense probably damaging 1.00
R9517:Frem1 UTSW 4 82983477 missense probably damaging 1.00
X0013:Frem1 UTSW 4 82914808 missense probably benign 0.38
X0017:Frem1 UTSW 4 82991633 critical splice acceptor site probably null
Z1088:Frem1 UTSW 4 82972267 missense probably damaging 1.00
Z1176:Frem1 UTSW 4 82999983 missense probably damaging 1.00
Z1177:Frem1 UTSW 4 82940315 critical splice donor site probably null
Z1177:Frem1 UTSW 4 83000269 missense probably benign 0.39
Z1177:Frem1 UTSW 4 83016464 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATCAAGCATAGGGAAGCAATCTTTC -3'
(R):5'- CTGGATGGACAGAACTTCATAGGAC -3'

Sequencing Primer
(F):5'- ACTGATATCTGGACCGCATG -3'
(R):5'- GGACAGAACTTCATAGGACTTGTGTC -3'
Posted On 2020-09-15