Mutagenetix > Incidental Mutation

Incidental Mutation 'R7976:Frem1'

650892

Institutional Source

Beutler Lab

Gene Symbol

Frem1

Ensembl Gene

ENSMUSG00000059049

Gene Name

Fras1 related extracellular matrix protein 1

Synonyms

eyes2, heb, eye, crf11, QBRICK

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.824) question?

Stock #

R7976 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

82897920-83052339 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 83001709 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 469 (V469A)

Ref Sequence

ENSEMBL: ENSMUSP00000071627 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000071708] [ENSMUST00000107230] [ENSMUST00000170248]

AlphaFold

Q684R7

Predicted Effect

probably damaging
Transcript: ENSMUST00000071708
AA Change: V469A

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000071627
Gene: ENSMUSG00000059049
AA Change: V469A

Domain	Start	End	E-Value	Type
signal peptide	1	29	N/A	INTRINSIC
Pfam:Cadherin_3	364	508	1.7e-37	PFAM
Pfam:Cadherin_3	509	623	3.7e-18	PFAM
Pfam:Cadherin_3	592	709	8.4e-16	PFAM
Pfam:Cadherin_3	746	894	4.8e-26	PFAM
Pfam:Cadherin_3	863	1009	2.8e-30	PFAM
Pfam:Cadherin_3	1024	1115	6.4e-13	PFAM
Pfam:Cadherin_3	1119	1252	1.4e-17	PFAM
Pfam:Cadherin_3	1243	1393	8.2e-35	PFAM
Pfam:Cadherin_3	1378	1506	2e-22	PFAM
Pfam:Cadherin_3	1506	1616	1e-29	PFAM
Pfam:Cadherin_3	1617	1744	1.5e-14	PFAM
Pfam:Calx-beta	1749	1848	2.6e-10	PFAM
low complexity region	1894	1910	N/A	INTRINSIC
CLECT	2065	2188	2.25e-27	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000107230
AA Change: V469A

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000102849
Gene: ENSMUSG00000059049
AA Change: V469A

Domain	Start	End	E-Value	Type
signal peptide	1	29	N/A	INTRINSIC
internal_repeat_1	296	967	9.01e-39	PROSPERO
internal_repeat_1	1026	1705	9.01e-39	PROSPERO
Pfam:Calx-beta	1730	1829	6.7e-10	PFAM
low complexity region	1875	1891	N/A	INTRINSIC
CLECT	2046	2169	2.25e-27	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000170248
AA Change: V470A

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000125809
Gene: ENSMUSG00000059049
AA Change: V470A

Domain	Start	End	E-Value	Type
signal peptide	1	29	N/A	INTRINSIC
Pfam:Cadherin_3	365	509	1.3e-37	PFAM
Pfam:Cadherin_3	510	623	4.5e-18	PFAM
Pfam:Cadherin_3	593	711	6.1e-16	PFAM
Pfam:Cadherin_3	728	876	2.7e-27	PFAM
Pfam:Cadherin_3	845	991	2.1e-30	PFAM
Pfam:Cadherin_3	1006	1097	4.8e-13	PFAM
Pfam:Cadherin_3	1101	1234	1e-17	PFAM
Pfam:Cadherin_3	1225	1375	6.1e-35	PFAM
Pfam:Cadherin_3	1360	1488	1.5e-22	PFAM
Pfam:Cadherin_3	1488	1598	7.5e-30	PFAM
Pfam:Cadherin_3	1599	1726	1.1e-14	PFAM
Pfam:Calx-beta	1731	1830	6.4e-10	PFAM
low complexity region	1876	1892	N/A	INTRINSIC
CLECT	2047	2170	2.25e-27	SMART

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a basement membrane protein that may play a role in craniofacial and renal development. Mutations in this gene have been associated with bifid nose with or without anorectal and renal anomalies. Alternatively spliced transcript variants encoding different isoforms have been described. PubMed ID 19940113 describes one such variant that initiates transcription within a distinct, internal exon; the resulting shorter isoform (named Toll-like/interleukin-1 receptor regulator, TILRR) is suggested to be a co-receptor of the interleukin 1 receptor family and may regulate receptor function and Toll-like receptor/interleukin 1 receptor signal transduction, contributing to the control of inflammatory response activation. [provided by RefSeq, Apr 2011]
PHENOTYPE: Homozygous mutation of this gene results in subepidermal blistering, cryptophthalmos, syndactyly, and renal agenesis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 70 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adssl1	A	C	12: 112,636,397	I341L	probably benign	Het
Aldh1b1	T	A	4: 45,803,092	M210K	possibly damaging	Het
Ankrd17	G	A	5: 90,283,592	Q778*	probably null	Het
Bmper	T	C	9: 23,406,810	V575A	probably damaging	Het
Brinp2	A	G	1: 158,246,343	V736A	probably benign	Het
Ccdc81	A	T	7: 89,866,515	L652*	probably null	Het
Cdt1	C	T	8: 122,571,846	R437W	probably damaging	Het
Ckb	A	C	12: 111,671,032	L165R	possibly damaging	Het
Col25a1	G	T	3: 130,496,426	G255V	probably damaging	Het
Ddx17	A	G	15: 79,535,955		probably null	Het
Ddx58	T	C	4: 40,209,894	M725V	probably damaging	Het
Dennd4a	G	T	9: 64,852,512	G300W	possibly damaging	Het
Dlg4	T	A	11: 70,039,182	I316N	probably damaging	Het
Dlgap2	C	T	8: 14,743,410	P467L	probably benign	Het
Dnah9	T	C	11: 65,841,401	I4226M	possibly damaging	Het
Drc1	G	A	5: 30,364,485	A734T	probably benign	Het
Entpd1	A	G	19: 40,612,421	M1V	probably null	Het
Exph5	T	G	9: 53,376,635	I1672S	possibly damaging	Het
Fam149b	T	A	14: 20,377,784	D379E	probably damaging	Het
Fgfr2	T	C	7: 130,185,344	T461A	probably damaging	Het
Frem3	A	T	8: 80,611,602	K175*	probably null	Het
Fsd2	C	T	7: 81,559,881	G71E	probably benign	Het
Gcat	T	C	15: 79,034,988	I116T	probably damaging	Het
Gigyf2	G	A	1: 87,403,736	S202N	unknown	Het
Glra3	T	G	8: 56,112,876		probably null	Het
Golga4	C	T	9: 118,536,768	T296I	possibly damaging	Het
Herc1	C	T	9: 66,434,270	T1816I	possibly damaging	Het
Igfbpl1	C	A	4: 45,826,786	R3L	unknown	Het
Ighv15-2	A	T	12: 114,564,850	S28T	probably benign	Het
Kat2b	T	A	17: 53,648,807	M427K	probably benign	Het
Kdm4c	A	G	4: 74,377,669	T882A	probably damaging	Het
Kif1a	G	T	1: 93,039,774	F1138L	probably damaging	Het
Klhl20	A	T	1: 161,106,737	S237R	probably benign	Het
Lamc1	A	T	1: 153,247,268	N725K	probably damaging	Het
Lmtk3	A	G	7: 45,795,466	D1191G	unknown	Het
Ltbp1	C	A	17: 75,363,363	N1466K	possibly damaging	Het
Ly75	T	C	2: 60,365,088	E242G	probably damaging	Het
Lyrm1	T	C	7: 119,916,226	V113A	probably benign	Het
Mfsd13a	G	T	19: 46,372,007	A333S	probably benign	Het
Mllt10	T	C	2: 18,162,403	S380P	possibly damaging	Het
Mrc2	A	G	11: 105,348,003	K1295E	possibly damaging	Het
Muc5ac	A	T	7: 141,809,791	I2280F	unknown	Het
Neurod2	A	C	11: 98,327,197	F380L	probably damaging	Het
Ntrk3	G	A	7: 78,356,206	A469V	probably damaging	Het
Nup205	T	C	6: 35,198,953	F584L	probably damaging	Het
Oas1d	A	T	5: 120,919,147	Y272F	probably damaging	Het
Olfm3	T	C	3: 115,081,145	V30A	probably benign	Het
Olfr1054	A	G	2: 86,332,720	V212A	probably benign	Het
Olfr1215	T	A	2: 89,001,629	I220F	probably damaging	Het
Olfr1472	A	G	19: 13,454,199	I106T	probably benign	Het
Pcdhga12	A	G	18: 37,768,374	Y753C	probably damaging	Het
Phox2b	A	G	5: 67,096,171	V294A	unknown	Het
Prdm2	A	T	4: 143,133,242	C1159*	probably null	Het
Ptpn12	G	T	5: 21,002,633	S275*	probably null	Het
Rnf223	A	T	4: 156,132,319	E50D	probably damaging	Het
Rrp12	A	T	19: 41,891,109	Y169N	probably benign	Het
Sgip1	T	C	4: 102,900,539		probably null	Het
Shank2	T	C	7: 144,411,061	I802T	probably damaging	Het
Skint2	A	T	4: 112,624,132	N64I	probably damaging	Het
Smpd3	A	C	8: 106,255,622	C617G	probably benign	Het
Tmem106c	G	C	15: 97,968,104	G192R	probably damaging	Het
Tmem72	T	C	6: 116,696,839	H106R	probably damaging	Het
Upf2	G	C	2: 6,026,115	V789L	unknown	Het
Vash1	A	G	12: 86,679,984		probably benign	Het
Vmn1r201	T	A	13: 22,474,705	Y30N	probably benign	Het
Xpr1	A	G	1: 155,290,289	F571L	possibly damaging	Het
Yif1a	T	C	19: 5,089,787	S87P	probably damaging	Het
Zer1	T	C	2: 30,107,508	Y462C	probably damaging	Het
Zfp597	G	A	16: 3,866,511	P127L	possibly damaging	Het
Zxdc	T	C	6: 90,398,767	S742P	probably benign	Het

Other mutations in Frem1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00155:Frem1	APN	4	82959389	missense	possibly damaging	0.46
IGL01069:Frem1	APN	4	83013867	missense	probably benign	0.00
IGL01106:Frem1	APN	4	82922257	missense	probably benign	0.00
IGL01398:Frem1	APN	4	82950362	missense	possibly damaging	0.64
IGL01617:Frem1	APN	4	82936139	missense	probably benign	0.02
IGL01647:Frem1	APN	4	82950356	missense	possibly damaging	0.60
IGL01690:Frem1	APN	4	82959296	splice site	probably benign
IGL02006:Frem1	APN	4	82992800	critical splice donor site	probably null
IGL02069:Frem1	APN	4	82903551	missense	probably damaging	1.00
IGL02131:Frem1	APN	4	82924854	missense	probably benign	0.03
IGL02225:Frem1	APN	4	82940506	missense	probably damaging	1.00
IGL02439:Frem1	APN	4	82956345	missense	probably benign	0.00
IGL02567:Frem1	APN	4	83000055	missense	probably damaging	1.00
IGL02647:Frem1	APN	4	83001754	missense	probably damaging	1.00
IGL02653:Frem1	APN	4	82959334	missense	probably benign	0.22
IGL02831:Frem1	APN	4	82956158	missense	probably benign	0.31
IGL02997:Frem1	APN	4	82934968	missense	probably damaging	1.00
IGL03005:Frem1	APN	4	82994134	missense	probably damaging	1.00
IGL03036:Frem1	APN	4	82959339	missense	possibly damaging	0.55
IGL03193:Frem1	APN	4	82994026	splice site	probably benign
IGL03218:Frem1	APN	4	82914646	missense	probably benign	0.00
IGL03235:Frem1	APN	4	83020755	missense	possibly damaging	0.87
IGL03243:Frem1	APN	4	83013969	missense	probably damaging	1.00
bat	UTSW	4	82983060	intron	probably benign
blister	UTSW	4	83020770	missense	probably benign	0.28
R0519_frem1_373	UTSW	4	82970633	critical splice donor site	probably null
R4764_Frem1_085	UTSW	4	82989189	missense	probably damaging	1.00
R6165_Frem1_083	UTSW	4	82956255	missense	probably benign	0.16
R6324_Frem1_643	UTSW	4	82983337	missense	probably benign	0.00
PIT4131001:Frem1	UTSW	4	83005808	missense	probably damaging	0.99
PIT4466001:Frem1	UTSW	4	82972137	missense	probably benign	0.01
PIT4472001:Frem1	UTSW	4	82972137	missense	probably benign	0.01
PIT4515001:Frem1	UTSW	4	82900426	missense	probably damaging	0.98
PIT4531001:Frem1	UTSW	4	82950280	missense	probably benign	0.12
R0010:Frem1	UTSW	4	83000098	missense	probably benign	0.41
R0010:Frem1	UTSW	4	83000098	missense	probably benign	0.41
R0115:Frem1	UTSW	4	82936169	missense	possibly damaging	0.94
R0125:Frem1	UTSW	4	83011951	missense	probably damaging	1.00
R0280:Frem1	UTSW	4	82969444	missense	probably damaging	1.00
R0504:Frem1	UTSW	4	82912637	missense	probably benign	0.26
R0519:Frem1	UTSW	4	82970633	critical splice donor site	probably null
R0631:Frem1	UTSW	4	82972165	missense	probably damaging	1.00
R0645:Frem1	UTSW	4	82989166	missense	probably damaging	1.00
R0781:Frem1	UTSW	4	82950320	missense	probably damaging	0.99
R1110:Frem1	UTSW	4	82950320	missense	probably damaging	0.99
R1115:Frem1	UTSW	4	83020770	missense	probably benign	0.28
R1130:Frem1	UTSW	4	82916628	splice site	probably null
R1173:Frem1	UTSW	4	82950352	missense	probably benign	0.16
R1349:Frem1	UTSW	4	82922305	splice site	probably benign
R1464:Frem1	UTSW	4	83011879	missense	probably damaging	1.00
R1464:Frem1	UTSW	4	83011879	missense	probably damaging	1.00
R1658:Frem1	UTSW	4	83001808	missense	probably damaging	1.00
R1672:Frem1	UTSW	4	82998891	missense	probably benign	0.09
R1831:Frem1	UTSW	4	83020837	missense	possibly damaging	0.95
R1851:Frem1	UTSW	4	82950500	missense	probably damaging	0.98
R2014:Frem1	UTSW	4	83005852	missense	probably damaging	1.00
R2021:Frem1	UTSW	4	82913558	missense	probably benign	0.02
R2022:Frem1	UTSW	4	82913558	missense	probably benign	0.02
R2023:Frem1	UTSW	4	82913558	missense	probably benign	0.02
R2183:Frem1	UTSW	4	82991495	missense	probably benign	0.00
R2437:Frem1	UTSW	4	83000173	missense	probably damaging	1.00
R2520:Frem1	UTSW	4	82950290	missense	probably damaging	0.99
R3195:Frem1	UTSW	4	83014114	missense	probably damaging	0.99
R3196:Frem1	UTSW	4	83014114	missense	probably damaging	0.99
R3408:Frem1	UTSW	4	83011986	missense	probably damaging	1.00
R3411:Frem1	UTSW	4	82963179	missense	possibly damaging	0.51
R3742:Frem1	UTSW	4	83011867	missense	probably damaging	1.00
R3829:Frem1	UTSW	4	82998930	missense	probably damaging	1.00
R3888:Frem1	UTSW	4	82913607	missense	probably benign	0.41
R4329:Frem1	UTSW	4	82986537	missense	probably benign	0.01
R4364:Frem1	UTSW	4	82913251	missense	probably damaging	0.99
R4411:Frem1	UTSW	4	82963244	missense	probably damaging	1.00
R4624:Frem1	UTSW	4	82989106	missense	probably damaging	1.00
R4687:Frem1	UTSW	4	83020631	missense	probably damaging	1.00
R4764:Frem1	UTSW	4	82989189	missense	probably damaging	1.00
R4801:Frem1	UTSW	4	82916628	splice site	probably benign
R4802:Frem1	UTSW	4	82916628	splice site	probably benign
R4854:Frem1	UTSW	4	82916758	missense	possibly damaging	0.88
R4872:Frem1	UTSW	4	82963150	missense	probably damaging	1.00
R4947:Frem1	UTSW	4	82966134	missense	probably damaging	0.99
R5007:Frem1	UTSW	4	82940812	intron	probably benign
R5103:Frem1	UTSW	4	82991612	missense	probably benign
R5369:Frem1	UTSW	4	83001739	missense	possibly damaging	0.61
R5494:Frem1	UTSW	4	82940753	makesense	probably null
R5694:Frem1	UTSW	4	82994116	missense	probably damaging	1.00
R5780:Frem1	UTSW	4	82950415	missense	probably benign	0.12
R5813:Frem1	UTSW	4	83000158	missense	probably damaging	1.00
R5843:Frem1	UTSW	4	82936052	missense	probably damaging	1.00
R5914:Frem1	UTSW	4	83001775	missense	probably damaging	1.00
R5985:Frem1	UTSW	4	82966050	missense	probably benign
R6091:Frem1	UTSW	4	82900559	missense	probably benign	0.01
R6165:Frem1	UTSW	4	82956255	missense	probably benign	0.16
R6324:Frem1	UTSW	4	82983337	missense	probably benign	0.00
R6369:Frem1	UTSW	4	82913792	splice site	probably null
R6414:Frem1	UTSW	4	82940536	missense	probably damaging	0.98
R6421:Frem1	UTSW	4	82994128	missense	probably damaging	1.00
R6434:Frem1	UTSW	4	82966016	missense	probably benign	0.03
R6453:Frem1	UTSW	4	82914825	nonsense	probably null
R6598:Frem1	UTSW	4	83013828	missense	probably damaging	0.99
R6720:Frem1	UTSW	4	83013832	missense	probably damaging	0.98
R6862:Frem1	UTSW	4	83012014	nonsense	probably null
R6922:Frem1	UTSW	4	82922269	missense	probably damaging	1.00
R6931:Frem1	UTSW	4	82970677	missense	probably damaging	1.00
R6992:Frem1	UTSW	4	82940362	missense	possibly damaging	0.62
R6995:Frem1	UTSW	4	82986601	missense	probably damaging	1.00
R7001:Frem1	UTSW	4	82986561	missense	probably benign	0.44
R7104:Frem1	UTSW	4	82940681	missense	probably benign	0.30
R7146:Frem1	UTSW	4	82922295	missense	possibly damaging	0.93
R7174:Frem1	UTSW	4	82922256	missense	probably benign	0.00
R7327:Frem1	UTSW	4	83020755	missense	possibly damaging	0.87
R7343:Frem1	UTSW	4	82994122	missense	probably damaging	0.99
R7368:Frem1	UTSW	4	82966144	missense	probably benign	0.19
R7392:Frem1	UTSW	4	83013827	missense	probably benign	0.06
R7465:Frem1	UTSW	4	82914835	missense	probably benign	0.11
R7499:Frem1	UTSW	4	83005770	missense	probably damaging	1.00
R7536:Frem1	UTSW	4	82956195	missense	probably damaging	1.00
R7752:Frem1	UTSW	4	82959377	missense	probably benign	0.02
R7753:Frem1	UTSW	4	82913980	missense	probably benign	0.03
R7790:Frem1	UTSW	4	82989164	missense	probably benign	0.02
R7818:Frem1	UTSW	4	83014008	missense	probably damaging	1.00
R7877:Frem1	UTSW	4	83013812	critical splice donor site	probably null
R7878:Frem1	UTSW	4	83020680	missense	probably benign	0.00
R7886:Frem1	UTSW	4	83016406	missense	possibly damaging	0.68
R7901:Frem1	UTSW	4	82959377	missense	probably benign	0.02
R8240:Frem1	UTSW	4	82956248	missense	probably benign	0.21
R8305:Frem1	UTSW	4	82999989	missense	probably benign	0.06
R8415:Frem1	UTSW	4	83000262	missense	probably damaging	1.00
R8751:Frem1	UTSW	4	82970778	missense	probably damaging	1.00
R8819:Frem1	UTSW	4	82903517	missense	probably damaging	1.00
R8820:Frem1	UTSW	4	82903517	missense	probably damaging	1.00
R8829:Frem1	UTSW	4	83000194	missense	probably damaging	1.00
R8834:Frem1	UTSW	4	83004373	missense	probably damaging	1.00
R8857:Frem1	UTSW	4	83004043	intron	probably benign
R8910:Frem1	UTSW	4	82950457	missense	probably benign	0.09
R9036:Frem1	UTSW	4	82913548	missense	probably benign
R9228:Frem1	UTSW	4	83001820	missense	probably damaging	1.00
R9382:Frem1	UTSW	4	82983385	missense	possibly damaging	0.79
R9441:Frem1	UTSW	4	83005846	missense	probably damaging	1.00
R9492:Frem1	UTSW	4	83001820	missense	probably damaging	1.00
R9517:Frem1	UTSW	4	82983477	missense	probably damaging	1.00
X0013:Frem1	UTSW	4	82914808	missense	probably benign	0.38
X0017:Frem1	UTSW	4	82991633	critical splice acceptor site	probably null
Z1088:Frem1	UTSW	4	82972267	missense	probably damaging	1.00
Z1176:Frem1	UTSW	4	82999983	missense	probably damaging	1.00
Z1177:Frem1	UTSW	4	82940315	critical splice donor site	probably null
Z1177:Frem1	UTSW	4	83000269	missense	probably benign	0.39
Z1177:Frem1	UTSW	4	83016464	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CATCAAGCATAGGGAAGCAATCTTTC -3'
(R):5'- CTGGATGGACAGAACTTCATAGGAC -3'

Sequencing Primer
(F):5'- ACTGATATCTGGACCGCATG -3'
(R):5'- GGACAGAACTTCATAGGACTTGTGTC -3'

Posted On

2020-09-15