Incidental Mutation 'R7976:Dlgap2'
ID 650913
Institutional Source Beutler Lab
Gene Symbol Dlgap2
Ensembl Gene ENSMUSG00000047495
Gene Name DLG associated protein 2
Synonyms PSD-95/SAP90-binding protein 2, DAP2, Sapap2, 6430596N04Rik, SAP90/PSD-95-associated protein 2
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R7976 (G1)
Quality Score 225.009
Status Not validated
Chromosome 8
Chromosomal Location 14095865-14847680 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 14743410 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Proline to Leucine at position 467 (P467L)
Ref Sequence ENSEMBL: ENSMUSP00000123104 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043279] [ENSMUST00000133298] [ENSMUST00000150247] [ENSMUST00000152652]
AlphaFold Q8BJ42
Predicted Effect probably benign
Transcript: ENSMUST00000043279
AA Change: P467L

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000039647
Gene: ENSMUSG00000047495
AA Change: P467L

DomainStartEndE-ValueType
low complexity region 269 294 N/A INTRINSIC
low complexity region 297 310 N/A INTRINSIC
low complexity region 446 456 N/A INTRINSIC
low complexity region 543 556 N/A INTRINSIC
low complexity region 614 628 N/A INTRINSIC
Pfam:GKAP 707 1059 1.5e-151 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000133298
AA Change: P467L

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000119613
Gene: ENSMUSG00000047495
AA Change: P467L

DomainStartEndE-ValueType
low complexity region 269 294 N/A INTRINSIC
low complexity region 297 310 N/A INTRINSIC
low complexity region 446 456 N/A INTRINSIC
low complexity region 543 556 N/A INTRINSIC
low complexity region 614 628 N/A INTRINSIC
Pfam:GKAP 707 1059 1.5e-151 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000150247
AA Change: P467L

PolyPhen 2 Score 0.375 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000123104
Gene: ENSMUSG00000047495
AA Change: P467L

DomainStartEndE-ValueType
low complexity region 269 294 N/A INTRINSIC
low complexity region 297 310 N/A INTRINSIC
low complexity region 446 456 N/A INTRINSIC
low complexity region 543 556 N/A INTRINSIC
low complexity region 614 628 N/A INTRINSIC
Pfam:GKAP 707 1045 1e-151 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000152652
AA Change: P468L

PolyPhen 2 Score 0.125 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000123078
Gene: ENSMUSG00000047495
AA Change: P468L

DomainStartEndE-ValueType
low complexity region 270 295 N/A INTRINSIC
low complexity region 298 311 N/A INTRINSIC
low complexity region 447 457 N/A INTRINSIC
low complexity region 544 557 N/A INTRINSIC
low complexity region 615 629 N/A INTRINSIC
Pfam:GKAP 715 1060 1.9e-160 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is a membrane-associated protein that may play a role in synapse organization and signalling in neuronal cells. This gene is biallelically expressed in the brain, however, only the paternal allele is expressed in the testis (PMID:18055845). Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jun 2014]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adssl1 A C 12: 112,636,397 I341L probably benign Het
Aldh1b1 T A 4: 45,803,092 M210K possibly damaging Het
Ankrd17 G A 5: 90,283,592 Q778* probably null Het
Bmper T C 9: 23,406,810 V575A probably damaging Het
Brinp2 A G 1: 158,246,343 V736A probably benign Het
Ccdc81 A T 7: 89,866,515 L652* probably null Het
Cdt1 C T 8: 122,571,846 R437W probably damaging Het
Ckb A C 12: 111,671,032 L165R possibly damaging Het
Col25a1 G T 3: 130,496,426 G255V probably damaging Het
Ddx17 A G 15: 79,535,955 probably null Het
Ddx58 T C 4: 40,209,894 M725V probably damaging Het
Dennd4a G T 9: 64,852,512 G300W possibly damaging Het
Dlg4 T A 11: 70,039,182 I316N probably damaging Het
Dnah9 T C 11: 65,841,401 I4226M possibly damaging Het
Drc1 G A 5: 30,364,485 A734T probably benign Het
Entpd1 A G 19: 40,612,421 M1V probably null Het
Exph5 T G 9: 53,376,635 I1672S possibly damaging Het
Fam149b T A 14: 20,377,784 D379E probably damaging Het
Fgfr2 T C 7: 130,185,344 T461A probably damaging Het
Frem1 A G 4: 83,001,709 V469A probably damaging Het
Frem3 A T 8: 80,611,602 K175* probably null Het
Fsd2 C T 7: 81,559,881 G71E probably benign Het
Gcat T C 15: 79,034,988 I116T probably damaging Het
Gigyf2 G A 1: 87,403,736 S202N unknown Het
Glra3 T G 8: 56,112,876 probably null Het
Golga4 C T 9: 118,536,768 T296I possibly damaging Het
Herc1 C T 9: 66,434,270 T1816I possibly damaging Het
Igfbpl1 C A 4: 45,826,786 R3L unknown Het
Ighv15-2 A T 12: 114,564,850 S28T probably benign Het
Kat2b T A 17: 53,648,807 M427K probably benign Het
Kdm4c A G 4: 74,377,669 T882A probably damaging Het
Kif1a G T 1: 93,039,774 F1138L probably damaging Het
Klhl20 A T 1: 161,106,737 S237R probably benign Het
Lamc1 A T 1: 153,247,268 N725K probably damaging Het
Lmtk3 A G 7: 45,795,466 D1191G unknown Het
Ltbp1 C A 17: 75,363,363 N1466K possibly damaging Het
Ly75 T C 2: 60,365,088 E242G probably damaging Het
Lyrm1 T C 7: 119,916,226 V113A probably benign Het
Mfsd13a G T 19: 46,372,007 A333S probably benign Het
Mllt10 T C 2: 18,162,403 S380P possibly damaging Het
Mrc2 A G 11: 105,348,003 K1295E possibly damaging Het
Muc5ac A T 7: 141,809,791 I2280F unknown Het
Neurod2 A C 11: 98,327,197 F380L probably damaging Het
Ntrk3 G A 7: 78,356,206 A469V probably damaging Het
Nup205 T C 6: 35,198,953 F584L probably damaging Het
Oas1d A T 5: 120,919,147 Y272F probably damaging Het
Olfm3 T C 3: 115,081,145 V30A probably benign Het
Olfr1054 A G 2: 86,332,720 V212A probably benign Het
Olfr1215 T A 2: 89,001,629 I220F probably damaging Het
Olfr1472 A G 19: 13,454,199 I106T probably benign Het
Pcdhga12 A G 18: 37,768,374 Y753C probably damaging Het
Phox2b A G 5: 67,096,171 V294A unknown Het
Prdm2 A T 4: 143,133,242 C1159* probably null Het
Ptpn12 G T 5: 21,002,633 S275* probably null Het
Rnf223 A T 4: 156,132,319 E50D probably damaging Het
Rrp12 A T 19: 41,891,109 Y169N probably benign Het
Sgip1 T C 4: 102,900,539 probably null Het
Shank2 T C 7: 144,411,061 I802T probably damaging Het
Skint2 A T 4: 112,624,132 N64I probably damaging Het
Smpd3 A C 8: 106,255,622 C617G probably benign Het
Tmem106c G C 15: 97,968,104 G192R probably damaging Het
Tmem72 T C 6: 116,696,839 H106R probably damaging Het
Upf2 G C 2: 6,026,115 V789L unknown Het
Vash1 A G 12: 86,679,984 probably benign Het
Vmn1r201 T A 13: 22,474,705 Y30N probably benign Het
Xpr1 A G 1: 155,290,289 F571L possibly damaging Het
Yif1a T C 19: 5,089,787 S87P probably damaging Het
Zer1 T C 2: 30,107,508 Y462C probably damaging Het
Zfp597 G A 16: 3,866,511 P127L possibly damaging Het
Zxdc T C 6: 90,398,767 S742P probably benign Het
Other mutations in Dlgap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01476:Dlgap2 APN 8 14778301 nonsense probably null
IGL01788:Dlgap2 APN 8 14843631 missense probably benign 0.19
IGL02054:Dlgap2 APN 8 14843552 missense probably damaging 0.98
IGL02969:Dlgap2 APN 8 14831579 missense possibly damaging 0.95
IGL03183:Dlgap2 APN 8 14727525 missense possibly damaging 0.62
IGL03303:Dlgap2 APN 8 14727812 missense probably damaging 0.99
G1Funyon:Dlgap2 UTSW 8 14823577 missense probably benign 0.27
PIT4403001:Dlgap2 UTSW 8 14831528 missense probably damaging 1.00
R0026:Dlgap2 UTSW 8 14727363 nonsense probably null
R0242:Dlgap2 UTSW 8 14727562 missense probably benign 0.34
R0242:Dlgap2 UTSW 8 14727562 missense probably benign 0.34
R0647:Dlgap2 UTSW 8 14727591 missense possibly damaging 0.95
R1221:Dlgap2 UTSW 8 14726952 missense probably benign 0.08
R1374:Dlgap2 UTSW 8 14831228 splice site probably benign
R1440:Dlgap2 UTSW 8 14727060 missense probably benign
R1544:Dlgap2 UTSW 8 14829861 splice site probably null
R1550:Dlgap2 UTSW 8 14822499 missense probably damaging 0.98
R1804:Dlgap2 UTSW 8 14727809 missense possibly damaging 0.71
R1870:Dlgap2 UTSW 8 14773347 missense probably damaging 1.00
R1921:Dlgap2 UTSW 8 14843624 missense probably benign 0.10
R2119:Dlgap2 UTSW 8 14778206 missense possibly damaging 0.69
R2193:Dlgap2 UTSW 8 14743431 missense possibly damaging 0.51
R4381:Dlgap2 UTSW 8 14846502 missense probably benign
R4422:Dlgap2 UTSW 8 14743463 critical splice donor site probably null
R4521:Dlgap2 UTSW 8 14727871 missense probably damaging 1.00
R4581:Dlgap2 UTSW 8 14846679 missense probably damaging 1.00
R4585:Dlgap2 UTSW 8 14727999 critical splice donor site probably null
R4760:Dlgap2 UTSW 8 14773380 missense probably damaging 1.00
R5077:Dlgap2 UTSW 8 14822691 missense probably benign 0.35
R5373:Dlgap2 UTSW 8 14823614 missense probably benign 0.19
R5374:Dlgap2 UTSW 8 14823614 missense probably benign 0.19
R5552:Dlgap2 UTSW 8 14831342 nonsense probably null
R5964:Dlgap2 UTSW 8 14727128 nonsense probably null
R6125:Dlgap2 UTSW 8 14727193 missense possibly damaging 0.78
R6147:Dlgap2 UTSW 8 14727294 missense probably benign 0.05
R6163:Dlgap2 UTSW 8 14846641 missense probably damaging 1.00
R6269:Dlgap2 UTSW 8 14822369 missense probably benign 0.01
R6629:Dlgap2 UTSW 8 14831465 missense probably benign 0.00
R6765:Dlgap2 UTSW 8 14743284 missense probably benign 0.00
R6809:Dlgap2 UTSW 8 14179619 intron probably benign
R6913:Dlgap2 UTSW 8 14778374 missense probably benign 0.10
R7219:Dlgap2 UTSW 8 14743296 missense probably benign 0.00
R7485:Dlgap2 UTSW 8 14829952 missense probably damaging 0.97
R7560:Dlgap2 UTSW 8 14822697 critical splice donor site probably null
R7826:Dlgap2 UTSW 8 14743410 missense probably benign 0.38
R8101:Dlgap2 UTSW 8 14831600 missense probably benign 0.04
R8301:Dlgap2 UTSW 8 14823577 missense probably benign 0.27
R8333:Dlgap2 UTSW 8 14778295 missense probably benign 0.03
R8367:Dlgap2 UTSW 8 14843544 missense probably benign 0.00
R8492:Dlgap2 UTSW 8 14778271 missense possibly damaging 0.49
R8685:Dlgap2 UTSW 8 14831628 missense possibly damaging 0.71
R8690:Dlgap2 UTSW 8 14743430 missense probably benign 0.00
R8887:Dlgap2 UTSW 8 14179682 critical splice donor site probably null
R9328:Dlgap2 UTSW 8 14727441 missense probably damaging 1.00
R9338:Dlgap2 UTSW 8 14179683 critical splice donor site probably null
R9465:Dlgap2 UTSW 8 14778226 missense probably damaging 1.00
X0060:Dlgap2 UTSW 8 14839787 missense probably damaging 1.00
Z1088:Dlgap2 UTSW 8 14822472 missense probably benign 0.10
Z1177:Dlgap2 UTSW 8 14727659 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGGCACGATTGATATGGGC -3'
(R):5'- GCATCCTAAGATATCAATGAGAAGG -3'

Sequencing Primer
(F):5'- CACGATTGATATGGGCTGTCTC -3'
(R):5'- ATGAGAGAACAGATGACACAGGCTC -3'
Posted On 2020-09-15