Incidental Mutation 'R7976:Frem3'
ID650915
Institutional Source Beutler Lab
Gene Symbol Frem3
Ensembl Gene ENSMUSG00000042353
Gene NameFras1 related extracellular matrix protein 3
SynonymsLOC333315
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.111) question?
Stock #R7976 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location80611080-80695356 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 80611602 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 175 (K175*)
Ref Sequence ENSEMBL: ENSMUSP00000038015 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039695]
Predicted Effect probably null
Transcript: ENSMUST00000039695
AA Change: K175*
SMART Domains Protein: ENSMUSP00000038015
Gene: ENSMUSG00000042353
AA Change: K175*

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:Cadherin_3 369 515 9.5e-31 PFAM
Pfam:Cadherin_3 495 596 9.4e-20 PFAM
Pfam:Cadherin_3 637 786 4.2e-20 PFAM
Pfam:Cadherin_3 788 913 5.5e-23 PFAM
Pfam:Cadherin_3 998 1163 1.8e-20 PFAM
Pfam:Cadherin_3 1129 1254 1.3e-19 PFAM
Pfam:Cadherin_3 1250 1395 9.5e-34 PFAM
Pfam:Cadherin_3 1397 1508 2.7e-21 PFAM
Pfam:Cadherin_3 1493 1617 1.2e-27 PFAM
Pfam:Cadherin_3 1622 1748 4.8e-17 PFAM
Calx_beta 1754 1853 1.45e-7 SMART
Calx_beta 1866 1977 3.35e-12 SMART
Calx_beta 1991 2098 1.61e-5 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an integral membrane protein containing numerous CSPG (chondroitin sulfate proteoglycan element) repeats and Calx-beta domains. The protein belongs to the family of FRAS1/FREM extracellular matrix proteins and may play a role cell adhesion. [provided by RefSeq, Feb 2017]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adssl1 A C 12: 112,636,397 I341L probably benign Het
Aldh1b1 T A 4: 45,803,092 M210K possibly damaging Het
Ankrd17 G A 5: 90,283,592 Q778* probably null Het
Bmper T C 9: 23,406,810 V575A probably damaging Het
Brinp2 A G 1: 158,246,343 V736A probably benign Het
Ccdc81 A T 7: 89,866,515 L652* probably null Het
Cdt1 C T 8: 122,571,846 R437W probably damaging Het
Ckb A C 12: 111,671,032 L165R possibly damaging Het
Col25a1 G T 3: 130,496,426 G255V probably damaging Het
Ddx17 A G 15: 79,535,955 probably null Het
Ddx58 T C 4: 40,209,894 M725V probably damaging Het
Dennd4a G T 9: 64,852,512 G300W possibly damaging Het
Dlg4 T A 11: 70,039,182 I316N probably damaging Het
Dlgap2 C T 8: 14,743,410 P467L probably benign Het
Dnah9 T C 11: 65,841,401 I4226M possibly damaging Het
Drc1 G A 5: 30,364,485 A734T probably benign Het
Entpd1 A G 19: 40,612,421 M1V probably null Het
Exph5 T G 9: 53,376,635 I1672S possibly damaging Het
Fam149b T A 14: 20,377,784 D379E probably damaging Het
Fgfr2 T C 7: 130,185,344 T461A probably damaging Het
Frem1 A G 4: 83,001,709 V469A probably damaging Het
Fsd2 C T 7: 81,559,881 G71E probably benign Het
Gcat T C 15: 79,034,988 I116T probably damaging Het
Gigyf2 G A 1: 87,403,736 S202N unknown Het
Glra3 T G 8: 56,112,876 probably null Het
Golga4 C T 9: 118,536,768 T296I possibly damaging Het
Herc1 C T 9: 66,434,270 T1816I possibly damaging Het
Igfbpl1 C A 4: 45,826,786 R3L unknown Het
Ighv15-2 A T 12: 114,564,850 S28T probably benign Het
Kat2b T A 17: 53,648,807 M427K probably benign Het
Kdm4c A G 4: 74,377,669 T882A probably damaging Het
Kif1a G T 1: 93,039,774 F1138L probably damaging Het
Klhl20 A T 1: 161,106,737 S237R probably benign Het
Lamc1 A T 1: 153,247,268 N725K probably damaging Het
Lmtk3 A G 7: 45,795,466 D1191G unknown Het
Ltbp1 C A 17: 75,363,363 N1466K possibly damaging Het
Ly75 T C 2: 60,365,088 E242G probably damaging Het
Lyrm1 T C 7: 119,916,226 V113A probably benign Het
Mfsd13a G T 19: 46,372,007 A333S probably benign Het
Mllt10 T C 2: 18,162,403 S380P possibly damaging Het
Mrc2 A G 11: 105,348,003 K1295E possibly damaging Het
Muc5ac A T 7: 141,809,791 I2280F unknown Het
Neurod2 A C 11: 98,327,197 F380L probably damaging Het
Ntrk3 G A 7: 78,356,206 A469V probably damaging Het
Nup205 T C 6: 35,198,953 F584L probably damaging Het
Oas1d A T 5: 120,919,147 Y272F probably damaging Het
Olfm3 T C 3: 115,081,145 V30A probably benign Het
Olfr1054 A G 2: 86,332,720 V212A probably benign Het
Olfr1215 T A 2: 89,001,629 I220F probably damaging Het
Olfr1472 A G 19: 13,454,199 I106T probably benign Het
Pcdhga12 A G 18: 37,768,374 Y753C probably damaging Het
Phox2b A G 5: 67,096,171 V294A unknown Het
Prdm2 A T 4: 143,133,242 C1159* probably null Het
Ptpn12 G T 5: 21,002,633 S275* probably null Het
Rnf223 A T 4: 156,132,319 E50D probably damaging Het
Rrp12 A T 19: 41,891,109 Y169N probably benign Het
Sgip1 T C 4: 102,900,539 probably null Het
Shank2 T C 7: 144,411,061 I802T probably damaging Het
Skint2 A T 4: 112,624,132 N64I probably damaging Het
Smpd3 A C 8: 106,255,622 C617G probably benign Het
Tmem106c G C 15: 97,968,104 G192R probably damaging Het
Tmem72 T C 6: 116,696,839 H106R probably damaging Het
Upf2 G C 2: 6,026,115 V789L unknown Het
Vash1 A G 12: 86,679,984 probably benign Het
Vmn1r201 T A 13: 22,474,705 Y30N probably benign Het
Xpr1 A G 1: 155,290,289 F571L possibly damaging Het
Yif1a T C 19: 5,089,787 S87P probably damaging Het
Zer1 T C 2: 30,107,508 Y462C probably damaging Het
Zfp597 G A 16: 3,866,511 P127L possibly damaging Het
Zxdc T C 6: 90,398,767 S742P probably benign Het
Other mutations in Frem3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00481:Frem3 APN 8 80668810 missense possibly damaging 0.75
IGL01019:Frem3 APN 8 80615134 missense probably benign 0.02
IGL01470:Frem3 APN 8 80614315 missense probably damaging 1.00
IGL01609:Frem3 APN 8 80612704 missense probably benign 0.00
IGL01622:Frem3 APN 8 80613915 missense probably benign 0.01
IGL01623:Frem3 APN 8 80613915 missense probably benign 0.01
IGL01751:Frem3 APN 8 80615743 missense probably benign 0.33
IGL02037:Frem3 APN 8 80611489 missense probably benign 0.31
IGL02039:Frem3 APN 8 80612971 missense probably damaging 1.00
IGL02084:Frem3 APN 8 80612443 missense possibly damaging 0.95
IGL02124:Frem3 APN 8 80613094 missense probably damaging 0.99
IGL02140:Frem3 APN 8 80614107 missense possibly damaging 0.84
IGL02836:Frem3 APN 8 80614381 missense probably benign
IGL03090:Frem3 APN 8 80618229 missense probably benign 0.01
IGL03102:Frem3 APN 8 80613032 missense possibly damaging 0.92
IGL03116:Frem3 APN 8 80612806 missense possibly damaging 0.84
IGL03165:Frem3 APN 8 80612529 missense probably benign 0.26
IGL03224:Frem3 APN 8 80613463 missense probably damaging 1.00
IGL03401:Frem3 APN 8 80614541 missense probably damaging 1.00
IGL03403:Frem3 APN 8 80611090 missense probably benign 0.04
FR4340:Frem3 UTSW 8 80615241 small insertion probably benign
FR4976:Frem3 UTSW 8 80615241 small insertion probably benign
IGL02991:Frem3 UTSW 8 80668882 missense probably damaging 1.00
IGL03052:Frem3 UTSW 8 80614530 missense probably damaging 1.00
R0089:Frem3 UTSW 8 80615878 missense possibly damaging 0.94
R0647:Frem3 UTSW 8 80615185 missense probably damaging 1.00
R0690:Frem3 UTSW 8 80613952 missense possibly damaging 0.84
R0766:Frem3 UTSW 8 80615322 missense probably benign
R0834:Frem3 UTSW 8 80687008 missense probably damaging 1.00
R0909:Frem3 UTSW 8 80663406 missense probably benign 0.45
R1033:Frem3 UTSW 8 80695157 missense probably benign 0.00
R1144:Frem3 UTSW 8 80611884 missense probably benign 0.01
R1312:Frem3 UTSW 8 80615322 missense probably benign
R1330:Frem3 UTSW 8 80668839 missense probably damaging 0.99
R1355:Frem3 UTSW 8 80690702 missense probably damaging 1.00
R1390:Frem3 UTSW 8 80690773 missense probably damaging 0.99
R1413:Frem3 UTSW 8 80668801 missense probably benign
R1470:Frem3 UTSW 8 80611191 missense probably benign 0.05
R1470:Frem3 UTSW 8 80611191 missense probably benign 0.05
R1503:Frem3 UTSW 8 80687018 missense probably damaging 0.99
R1538:Frem3 UTSW 8 80612710 missense probably damaging 1.00
R1538:Frem3 UTSW 8 80613135 missense probably benign 0.00
R1612:Frem3 UTSW 8 80614861 missense probably damaging 1.00
R1793:Frem3 UTSW 8 80613112 missense probably benign 0.03
R1872:Frem3 UTSW 8 80612576 missense probably damaging 1.00
R1879:Frem3 UTSW 8 80611938 nonsense probably null
R1886:Frem3 UTSW 8 80613885 missense probably benign 0.00
R1933:Frem3 UTSW 8 80612890 missense probably benign 0.00
R2027:Frem3 UTSW 8 80695337 missense possibly damaging 0.75
R2040:Frem3 UTSW 8 80615826 missense possibly damaging 0.92
R2050:Frem3 UTSW 8 80614891 missense probably damaging 1.00
R2079:Frem3 UTSW 8 80615103 missense probably benign 0.03
R2099:Frem3 UTSW 8 80615859 missense probably benign 0.06
R2120:Frem3 UTSW 8 80615457 missense probably benign 0.20
R2842:Frem3 UTSW 8 80669349 splice site probably null
R2845:Frem3 UTSW 8 80613220 missense probably damaging 1.00
R3015:Frem3 UTSW 8 80690773 missense probably damaging 0.99
R3442:Frem3 UTSW 8 80613040 missense probably damaging 1.00
R3724:Frem3 UTSW 8 80615271 missense probably benign 0.06
R3730:Frem3 UTSW 8 80615916 missense probably damaging 0.99
R3939:Frem3 UTSW 8 80615020 missense possibly damaging 0.84
R3940:Frem3 UTSW 8 80615020 missense possibly damaging 0.84
R3941:Frem3 UTSW 8 80615020 missense possibly damaging 0.84
R4089:Frem3 UTSW 8 80615173 missense probably damaging 1.00
R4282:Frem3 UTSW 8 80614141 missense probably benign 0.00
R4437:Frem3 UTSW 8 80612607 missense probably benign 0.30
R4480:Frem3 UTSW 8 80611357 missense probably benign 0.10
R4575:Frem3 UTSW 8 80616075 missense probably benign 0.17
R4583:Frem3 UTSW 8 80613514 missense probably benign 0.03
R4620:Frem3 UTSW 8 80668957 missense possibly damaging 0.82
R4621:Frem3 UTSW 8 80669191 splice site probably null
R4644:Frem3 UTSW 8 80613727 missense probably benign 0.33
R4667:Frem3 UTSW 8 80663420 missense probably damaging 0.97
R4748:Frem3 UTSW 8 80611459 missense probably damaging 1.00
R4823:Frem3 UTSW 8 80613958 missense probably benign 0.25
R4836:Frem3 UTSW 8 80663397 missense probably damaging 0.99
R4867:Frem3 UTSW 8 80613283 missense probably damaging 1.00
R4921:Frem3 UTSW 8 80613136 missense possibly damaging 0.83
R5030:Frem3 UTSW 8 80613247 missense possibly damaging 0.89
R5035:Frem3 UTSW 8 80615914 missense probably damaging 0.97
R5172:Frem3 UTSW 8 80612566 missense probably benign 0.44
R5289:Frem3 UTSW 8 80612319 missense probably benign 0.00
R5492:Frem3 UTSW 8 80612677 missense probably damaging 1.00
R5655:Frem3 UTSW 8 80612694 missense probably benign 0.00
R5685:Frem3 UTSW 8 80695303 missense probably damaging 1.00
R5723:Frem3 UTSW 8 80613397 missense probably benign 0.02
R5743:Frem3 UTSW 8 80615778 missense probably damaging 0.98
R5889:Frem3 UTSW 8 80614288 missense probably damaging 1.00
R6048:Frem3 UTSW 8 80613433 missense probably benign 0.03
R6057:Frem3 UTSW 8 80615587 missense probably damaging 0.99
R6137:Frem3 UTSW 8 80615047 missense probably benign
R6264:Frem3 UTSW 8 80615203 missense probably damaging 1.00
R6339:Frem3 UTSW 8 80613015 missense possibly damaging 0.84
R6418:Frem3 UTSW 8 80611152 missense probably benign 0.08
R6680:Frem3 UTSW 8 80669320 missense probably damaging 1.00
R6773:Frem3 UTSW 8 80611815 missense probably damaging 1.00
R6838:Frem3 UTSW 8 80612031 missense probably damaging 1.00
R6928:Frem3 UTSW 8 80611282 missense possibly damaging 0.48
R6939:Frem3 UTSW 8 80615145 missense probably benign 0.23
R6995:Frem3 UTSW 8 80612579 missense probably damaging 0.98
R7112:Frem3 UTSW 8 80612031 missense probably damaging 1.00
R7155:Frem3 UTSW 8 80616039 missense probably benign 0.01
R7235:Frem3 UTSW 8 80690725 missense probably benign 0.00
R7282:Frem3 UTSW 8 80612031 missense probably damaging 1.00
R7403:Frem3 UTSW 8 80616145 missense probably damaging 1.00
R7422:Frem3 UTSW 8 80615763 missense probably benign 0.00
R7485:Frem3 UTSW 8 80613336 missense probably damaging 1.00
R7516:Frem3 UTSW 8 80612083 missense probably damaging 0.99
R7858:Frem3 UTSW 8 80611721 nonsense probably null
R8171:Frem3 UTSW 8 80615240 missense probably damaging 1.00
R8185:Frem3 UTSW 8 80612304 nonsense probably null
R8306:Frem3 UTSW 8 80612211 missense possibly damaging 0.95
R8518:Frem3 UTSW 8 80612595 missense probably damaging 1.00
RF030:Frem3 UTSW 8 80615238 small insertion probably benign
RF034:Frem3 UTSW 8 80615238 small insertion probably benign
RF042:Frem3 UTSW 8 80615238 small insertion probably benign
X0024:Frem3 UTSW 8 80613081 missense possibly damaging 0.76
X0027:Frem3 UTSW 8 80612388 nonsense probably null
Z1088:Frem3 UTSW 8 80615426 missense probably benign 0.04
Z1176:Frem3 UTSW 8 80611503 missense probably damaging 0.99
Z1176:Frem3 UTSW 8 80615431 missense probably benign 0.03
Z1177:Frem3 UTSW 8 80616129 missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- GCCCAACAGGTTAAGTACACTC -3'
(R):5'- TAGCATGGGCACATAGTCCC -3'

Sequencing Primer
(F):5'- AGGTTAAGTACACTCACTTCGGC -3'
(R):5'- CTGGATAAAAGCCTCACAGTCGG -3'
Posted On2020-09-15