Incidental Mutation 'R7976:Kat2b'
ID650937
Institutional Source Beutler Lab
Gene Symbol Kat2b
Ensembl Gene ENSMUSG00000000708
Gene NameK(lysine) acetyltransferase 2B
SynonymsPcaf, A930006P13Rik
MMRRC Submission
Accession Numbers

Genbank: NM_020005

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7976 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location53566861-53672720 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 53648807 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 427 (M427K)
Ref Sequence ENSEMBL: ENSMUSP00000000724 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000724] [ENSMUST00000166525]
Predicted Effect probably benign
Transcript: ENSMUST00000000724
AA Change: M427K

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000000724
Gene: ENSMUSG00000000708
AA Change: M427K

DomainStartEndE-ValueType
low complexity region 4 21 N/A INTRINSIC
low complexity region 32 55 N/A INTRINSIC
Pfam:PCAF_N 56 308 6.2e-114 PFAM
low complexity region 461 472 N/A INTRINSIC
Pfam:Acetyltransf_7 522 605 1.5e-11 PFAM
Pfam:Acetyltransf_1 530 604 3.2e-11 PFAM
low complexity region 643 659 N/A INTRINSIC
BROMO 702 810 1.08e-44 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000166525
AA Change: M34K

PolyPhen 2 Score 0.439 (Sensitivity: 0.89; Specificity: 0.90)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] CBP and p300 are large nuclear proteins that bind to many sequence-specific factors involved in cell growth and/or differentiation, including c-jun and the adenoviral oncoprotein E1A. The protein encoded by this gene associates with p300/CBP. It has in vitro and in vivo binding activity with CBP and p300, and competes with E1A for binding sites in p300/CBP. It has histone acetyl transferase activity with core histones and nucleosome core particles, indicating that this protein plays a direct role in transcriptional regulation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit no abrnomal phenotype. [provided by MGI curators]
Allele List at MGI

All alleles(122) : Targeted, knock-out(2) Targeted, other(1) Gene trapped(119)

Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adssl1 A C 12: 112,636,397 I341L probably benign Het
Aldh1b1 T A 4: 45,803,092 M210K possibly damaging Het
Ankrd17 G A 5: 90,283,592 Q778* probably null Het
Bmper T C 9: 23,406,810 V575A probably damaging Het
Brinp2 A G 1: 158,246,343 V736A probably benign Het
Ccdc81 A T 7: 89,866,515 L652* probably null Het
Cdt1 C T 8: 122,571,846 R437W probably damaging Het
Ckb A C 12: 111,671,032 L165R possibly damaging Het
Col25a1 G T 3: 130,496,426 G255V probably damaging Het
Ddx17 A G 15: 79,535,955 probably null Het
Ddx58 T C 4: 40,209,894 M725V probably damaging Het
Dennd4a G T 9: 64,852,512 G300W possibly damaging Het
Dlg4 T A 11: 70,039,182 I316N probably damaging Het
Dlgap2 C T 8: 14,743,410 P467L probably benign Het
Dnah9 T C 11: 65,841,401 I4226M possibly damaging Het
Drc1 G A 5: 30,364,485 A734T probably benign Het
Entpd1 A G 19: 40,612,421 M1V probably null Het
Exph5 T G 9: 53,376,635 I1672S possibly damaging Het
Fam149b T A 14: 20,377,784 D379E probably damaging Het
Fgfr2 T C 7: 130,185,344 T461A probably damaging Het
Frem1 A G 4: 83,001,709 V469A probably damaging Het
Frem3 A T 8: 80,611,602 K175* probably null Het
Fsd2 C T 7: 81,559,881 G71E probably benign Het
Gcat T C 15: 79,034,988 I116T probably damaging Het
Gigyf2 G A 1: 87,403,736 S202N unknown Het
Glra3 T G 8: 56,112,876 probably null Het
Golga4 C T 9: 118,536,768 T296I possibly damaging Het
Herc1 C T 9: 66,434,270 T1816I possibly damaging Het
Igfbpl1 C A 4: 45,826,786 R3L unknown Het
Ighv15-2 A T 12: 114,564,850 S28T probably benign Het
Kdm4c A G 4: 74,377,669 T882A probably damaging Het
Kif1a G T 1: 93,039,774 F1138L probably damaging Het
Klhl20 A T 1: 161,106,737 S237R probably benign Het
Lamc1 A T 1: 153,247,268 N725K probably damaging Het
Lmtk3 A G 7: 45,795,466 D1191G unknown Het
Ltbp1 C A 17: 75,363,363 N1466K possibly damaging Het
Ly75 T C 2: 60,365,088 E242G probably damaging Het
Lyrm1 T C 7: 119,916,226 V113A probably benign Het
Mfsd13a G T 19: 46,372,007 A333S probably benign Het
Mllt10 T C 2: 18,162,403 S380P possibly damaging Het
Mrc2 A G 11: 105,348,003 K1295E possibly damaging Het
Muc5ac A T 7: 141,809,791 I2280F unknown Het
Neurod2 A C 11: 98,327,197 F380L probably damaging Het
Ntrk3 G A 7: 78,356,206 A469V probably damaging Het
Nup205 T C 6: 35,198,953 F584L probably damaging Het
Oas1d A T 5: 120,919,147 Y272F probably damaging Het
Olfm3 T C 3: 115,081,145 V30A probably benign Het
Olfr1054 A G 2: 86,332,720 V212A probably benign Het
Olfr1215 T A 2: 89,001,629 I220F probably damaging Het
Olfr1472 A G 19: 13,454,199 I106T probably benign Het
Pcdhga12 A G 18: 37,768,374 Y753C probably damaging Het
Phox2b A G 5: 67,096,171 V294A unknown Het
Prdm2 A T 4: 143,133,242 C1159* probably null Het
Ptpn12 G T 5: 21,002,633 S275* probably null Het
Rnf223 A T 4: 156,132,319 E50D probably damaging Het
Rrp12 A T 19: 41,891,109 Y169N probably benign Het
Sgip1 T C 4: 102,900,539 probably null Het
Shank2 T C 7: 144,411,061 I802T probably damaging Het
Skint2 A T 4: 112,624,132 N64I probably damaging Het
Smpd3 A C 8: 106,255,622 C617G probably benign Het
Tmem106c G C 15: 97,968,104 G192R probably damaging Het
Tmem72 T C 6: 116,696,839 H106R probably damaging Het
Upf2 G C 2: 6,026,115 V789L unknown Het
Vash1 A G 12: 86,679,984 probably benign Het
Vmn1r201 T A 13: 22,474,705 Y30N probably benign Het
Xpr1 A G 1: 155,290,289 F571L possibly damaging Het
Yif1a T C 19: 5,089,787 S87P probably damaging Het
Zer1 T C 2: 30,107,508 Y462C probably damaging Het
Zfp597 G A 16: 3,866,511 P127L possibly damaging Het
Zxdc T C 6: 90,398,767 S742P probably benign Het
Other mutations in Kat2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00473:Kat2b APN 17 53663623 missense possibly damaging 0.46
IGL00793:Kat2b APN 17 53665824 missense probably benign 0.00
IGL01628:Kat2b APN 17 53610897 missense possibly damaging 0.89
IGL02494:Kat2b APN 17 53653205 missense probably damaging 1.00
IGL03347:Kat2b APN 17 53624351 critical splice acceptor site probably null
cakewalk UTSW 17 53638522 missense probably damaging 1.00
fracking UTSW 17 53624422 missense probably damaging 1.00
D605:Kat2b UTSW 17 53629330 missense probably damaging 1.00
R0060:Kat2b UTSW 17 53654543 missense probably damaging 1.00
R0225:Kat2b UTSW 17 53641210 missense probably damaging 1.00
R0372:Kat2b UTSW 17 53638537 missense possibly damaging 0.95
R0638:Kat2b UTSW 17 53644743 splice site probably benign
R0639:Kat2b UTSW 17 53567538 missense probably benign 0.38
R0780:Kat2b UTSW 17 53567448 missense unknown
R1240:Kat2b UTSW 17 53624397 missense probably benign 0.00
R2346:Kat2b UTSW 17 53610904 missense probably benign 0.07
R3402:Kat2b UTSW 17 53665853 missense probably damaging 1.00
R3776:Kat2b UTSW 17 53567581 splice site probably null
R4009:Kat2b UTSW 17 53644741 splice site probably null
R4011:Kat2b UTSW 17 53644741 splice site probably null
R4543:Kat2b UTSW 17 53653140 missense probably benign
R4598:Kat2b UTSW 17 53670798 missense probably benign 0.02
R4785:Kat2b UTSW 17 53653203 missense possibly damaging 0.81
R5079:Kat2b UTSW 17 53663638 missense probably damaging 1.00
R5475:Kat2b UTSW 17 53663581 missense probably damaging 1.00
R6993:Kat2b UTSW 17 53638522 missense probably damaging 1.00
R7047:Kat2b UTSW 17 53663569 missense probably benign 0.01
R7058:Kat2b UTSW 17 53665866 missense probably benign 0.00
R7199:Kat2b UTSW 17 53670678 missense probably damaging 1.00
R7276:Kat2b UTSW 17 53624422 missense probably damaging 1.00
R7418:Kat2b UTSW 17 53610925 missense possibly damaging 0.94
R7535:Kat2b UTSW 17 53624403 missense probably damaging 1.00
R7561:Kat2b UTSW 17 53641258 missense probably benign 0.22
R7723:Kat2b UTSW 17 53638387 missense possibly damaging 0.62
R8250:Kat2b UTSW 17 53663536 missense probably damaging 1.00
R8277:Kat2b UTSW 17 53641253 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGGGATACATGGCAAGACATTTTC -3'
(R):5'- CTTGGTTAGCCACTCCTGAC -3'

Sequencing Primer
(F):5'- ACATGGCAAGACATTTTCTCACTC -3'
(R):5'- CCTATAGTGGCCTCTAGGTTACAG -3'
Posted On2020-09-15