Incidental Mutation 'R7977:Myo3b'
ID650948
Institutional Source Beutler Lab
Gene Symbol Myo3b
Ensembl Gene ENSMUSG00000042064
Gene Namemyosin IIIB
SynonymsA430065P19Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7977 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location70039126-70429198 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 70330933 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 1174 (T1174A)
Ref Sequence ENSEMBL: ENSMUSP00000055362 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060208] [ENSMUST00000112243]
Predicted Effect probably benign
Transcript: ENSMUST00000060208
AA Change: T1174A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000055362
Gene: ENSMUSG00000042064
AA Change: T1174A

DomainStartEndE-ValueType
S_TKc 43 309 2.24e-85 SMART
MYSc 353 1075 6.61e-260 SMART
IQ 1075 1097 9.51e1 SMART
IQ 1102 1124 1.73e-5 SMART
low complexity region 1319 1324 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112243
AA Change: T1146A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000107862
Gene: ENSMUSG00000042064
AA Change: T1146A

DomainStartEndE-ValueType
S_TKc 15 281 2.24e-85 SMART
MYSc 325 1047 6.61e-260 SMART
IQ 1047 1069 9.51e1 SMART
IQ 1074 1096 1.73e-5 SMART
low complexity region 1291 1296 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the class III myosins. Myosins are ATPases, activated by actin, that move along actin filaments in the cell. This class of myosins are characterized by an amino-terminal kinase domain and shown to be present in photoreceptors. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Mar 2014]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9430097D07Rik G T 2: 32,574,305 Q161K unknown Het
Acsl5 T C 19: 55,277,973 probably null Het
Adgre1 T A 17: 57,447,987 I695N possibly damaging Het
Ank2 T C 3: 126,945,707 D2176G unknown Het
Atp6v0a2 G A 5: 124,719,986 G810D probably damaging Het
Bod1l A C 5: 41,795,070 N2868K probably damaging Het
Brd7 T C 8: 88,334,141 T526A probably benign Het
C9 T A 15: 6,467,462 Y213* probably null Het
Card6 T A 15: 5,100,525 N463I probably damaging Het
Ccdc81 T C 7: 89,876,111 Y485C probably damaging Het
Celsr1 A G 15: 86,032,993 F260L probably damaging Het
Dnah8 A G 17: 30,744,524 D2304G probably damaging Het
Dnase1 A G 16: 4,037,970 D55G probably damaging Het
Ecsit C A 9: 22,073,484 R296L probably damaging Het
Entpd8 A G 2: 25,084,766 D403G probably damaging Het
Epha2 C A 4: 141,308,480 Q76K probably damaging Het
Exoc1 T A 5: 76,543,585 V252E probably damaging Het
Fmnl3 T A 15: 99,328,098 H225L possibly damaging Het
Gm4565 A C 7: 22,583,387 M2R probably benign Het
Gpr146 G T 5: 139,392,685 A81S possibly damaging Het
Heg1 C A 16: 33,720,730 S419* probably null Het
Hps5 A C 7: 46,769,051 I865S probably benign Het
Hsp90ab1 A C 17: 45,571,606 I54S probably damaging Het
Hyal4 T G 6: 24,763,866 M342R probably damaging Het
Itgal A G 7: 127,328,298 T987A possibly damaging Het
Kat6b A G 14: 21,669,863 T1428A probably benign Het
Krt9 TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC 11: 100,189,077 probably benign Het
Ldlrad4 G T 18: 68,235,669 A66S possibly damaging Het
Lmtk2 A G 5: 144,175,141 D893G probably benign Het
Naf1 CGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGA CGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGA 8: 66,860,494 probably benign Het
Nsun5 G A 5: 135,375,680 R424H probably damaging Het
Oacyl A G 18: 65,698,391 E33G probably benign Het
Olfr77 T C 9: 19,920,314 F35S possibly damaging Het
Olfr798 T C 10: 129,625,969 I31V probably benign Het
Palm C T 10: 79,793,705 probably benign Het
Papln A G 12: 83,775,382 E337G probably damaging Het
Pira2 A T 7: 3,841,697 F445Y probably benign Het
Setd1b A G 5: 123,147,680 D263G unknown Het
Slc10a7 T A 8: 78,697,214 F202I probably benign Het
Smpd3 T C 8: 106,259,894 I455V probably benign Het
Snip1 G T 4: 125,066,939 G63W probably damaging Het
Sorl1 T A 9: 41,977,561 Y1981F probably damaging Het
Tagln2 A G 1: 172,505,253 T36A probably benign Het
Tnxb T C 17: 34,710,220 S2746P possibly damaging Het
Tob2 G A 15: 81,851,480 P96L probably damaging Het
Triobp T A 15: 79,001,544 Y1816N probably damaging Het
Trpc3 A G 3: 36,644,169 I647T probably benign Het
Ttn A G 2: 76,891,561 S6600P unknown Het
Vmn1r200 A T 13: 22,395,855 Y276F possibly damaging Het
Vmn1r230 T C 17: 20,846,897 I116T probably benign Het
Vmn1r26 A T 6: 58,008,279 Y308* probably null Het
Vmn2r16 C T 5: 109,340,149 T296I probably damaging Het
Wdfy2 A G 14: 62,951,931 D283G possibly damaging Het
Other mutations in Myo3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00736:Myo3b APN 2 70105645 splice site probably benign
IGL00959:Myo3b APN 2 70314292 missense probably damaging 1.00
IGL01069:Myo3b APN 2 70245391 missense probably benign 0.22
IGL01116:Myo3b APN 2 70289386 missense probably damaging 1.00
IGL02097:Myo3b APN 2 70238829 missense probably damaging 1.00
IGL02220:Myo3b APN 2 70289579 splice site probably benign
IGL02553:Myo3b APN 2 70095224 missense probably benign 0.00
IGL02557:Myo3b APN 2 70255319 missense probably benign 0.16
IGL02648:Myo3b APN 2 70105372 splice site probably benign
IGL02902:Myo3b APN 2 70289401 missense probably benign 0.36
IGL02981:Myo3b APN 2 70108625 missense probably damaging 1.00
IGL03030:Myo3b APN 2 70426816 splice site probably benign
IGL03031:Myo3b APN 2 70255377 missense possibly damaging 0.64
IGL03068:Myo3b APN 2 70426816 splice site probably benign
IGL03078:Myo3b APN 2 70286991 missense probably damaging 1.00
IGL03224:Myo3b APN 2 70349939 missense probably benign
IGL03329:Myo3b APN 2 70254459 missense probably damaging 1.00
R0079:Myo3b UTSW 2 70095158 missense possibly damaging 0.58
R0226:Myo3b UTSW 2 70217166 missense probably benign 0.00
R0238:Myo3b UTSW 2 70105425 missense probably benign 0.00
R0238:Myo3b UTSW 2 70105425 missense probably benign 0.00
R0239:Myo3b UTSW 2 70105425 missense probably benign 0.00
R0239:Myo3b UTSW 2 70105425 missense probably benign 0.00
R0313:Myo3b UTSW 2 70348959 nonsense probably null
R0331:Myo3b UTSW 2 70095261 missense probably damaging 1.00
R0371:Myo3b UTSW 2 70252960 splice site probably benign
R0442:Myo3b UTSW 2 70238961 critical splice donor site probably null
R0964:Myo3b UTSW 2 70426849 missense probably damaging 1.00
R1217:Myo3b UTSW 2 70330880 missense probably benign 0.02
R1429:Myo3b UTSW 2 70253007 missense probably damaging 0.97
R1460:Myo3b UTSW 2 70232454 missense probably benign 0.31
R1617:Myo3b UTSW 2 70281218 missense probably benign 0.00
R1628:Myo3b UTSW 2 70286962 missense probably benign 0.01
R1708:Myo3b UTSW 2 70245385 nonsense probably null
R1940:Myo3b UTSW 2 70258075 missense probably benign 0.01
R2407:Myo3b UTSW 2 70255253 missense probably damaging 1.00
R3081:Myo3b UTSW 2 70256583 splice site probably benign
R3687:Myo3b UTSW 2 70245314 missense probably benign
R3745:Myo3b UTSW 2 70234485 splice site probably benign
R4011:Myo3b UTSW 2 70096376 missense probably benign 0.15
R4074:Myo3b UTSW 2 70289464 missense probably damaging 1.00
R4419:Myo3b UTSW 2 70096362 missense probably damaging 1.00
R4496:Myo3b UTSW 2 70254404 missense probably benign
R4539:Myo3b UTSW 2 70039147 start codon destroyed probably null 0.00
R4643:Myo3b UTSW 2 70238842 missense possibly damaging 0.49
R4657:Myo3b UTSW 2 70238899 missense possibly damaging 0.95
R4807:Myo3b UTSW 2 70105712 missense probably damaging 1.00
R4849:Myo3b UTSW 2 70244909 missense probably damaging 0.98
R4997:Myo3b UTSW 2 70258083 missense possibly damaging 0.49
R5008:Myo3b UTSW 2 70258068 missense probably damaging 0.99
R5070:Myo3b UTSW 2 70253112 missense probably damaging 1.00
R5072:Myo3b UTSW 2 70095249 missense possibly damaging 0.96
R5082:Myo3b UTSW 2 70258030 missense probably benign 0.01
R5103:Myo3b UTSW 2 70096403 missense probably benign 0.08
R5109:Myo3b UTSW 2 70095293 missense possibly damaging 0.66
R5304:Myo3b UTSW 2 70426888 missense probably damaging 0.97
R5396:Myo3b UTSW 2 70126985 missense probably damaging 0.99
R5400:Myo3b UTSW 2 70105380 missense probably damaging 1.00
R5468:Myo3b UTSW 2 70234441 missense probably benign 0.00
R5620:Myo3b UTSW 2 70238910 missense probably benign 0.04
R5646:Myo3b UTSW 2 70314430 missense probably damaging 0.97
R5729:Myo3b UTSW 2 70105739 missense probably damaging 1.00
R5943:Myo3b UTSW 2 70286941 missense probably benign 0.03
R5971:Myo3b UTSW 2 70238899 missense possibly damaging 0.95
R6091:Myo3b UTSW 2 70238769 missense probably benign 0.00
R6138:Myo3b UTSW 2 70238899 missense possibly damaging 0.95
R6164:Myo3b UTSW 2 70245410 critical splice donor site probably null
R6177:Myo3b UTSW 2 70313363 missense probably benign 0.00
R6421:Myo3b UTSW 2 70313356 missense probably benign 0.02
R6478:Myo3b UTSW 2 70348960 missense probably benign
R6606:Myo3b UTSW 2 70232485 missense possibly damaging 0.94
R6752:Myo3b UTSW 2 70289512 missense probably damaging 1.00
R6982:Myo3b UTSW 2 70426065 missense probably benign 0.02
R6997:Myo3b UTSW 2 70126985 missense probably damaging 0.99
R7032:Myo3b UTSW 2 70095264 missense probably damaging 0.98
R7038:Myo3b UTSW 2 70095208 missense probably benign 0.00
R7062:Myo3b UTSW 2 70217157 missense probably benign 0.00
R7537:Myo3b UTSW 2 70217169 missense probably benign 0.01
R7861:Myo3b UTSW 2 70108688 missense probably damaging 1.00
R7955:Myo3b UTSW 2 70095279 missense probably benign 0.37
R7978:Myo3b UTSW 2 70253114 missense probably damaging 1.00
R7987:Myo3b UTSW 2 70330933 missense probably benign
U15987:Myo3b UTSW 2 70238899 missense possibly damaging 0.95
X0025:Myo3b UTSW 2 70232403 missense probably benign 0.00
X0065:Myo3b UTSW 2 70257969 missense probably damaging 1.00
Z1177:Myo3b UTSW 2 70096361 missense probably damaging 1.00
Z1177:Myo3b UTSW 2 70258027 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGCACGCTTGATTTAGTGGC -3'
(R):5'- AAGAGCTCCTGTGGTGAGAC -3'

Sequencing Primer
(F):5'- CGCTTGATTTAGTGGCAATACCCTAG -3'
(R):5'- AGCGCCTGTCTAATAAGCTG -3'
Posted On2020-09-15