Incidental Mutation 'R7977:Atp6v0a2'
ID650958
Institutional Source Beutler Lab
Gene Symbol Atp6v0a2
Ensembl Gene ENSMUSG00000038023
Gene NameATPase, H+ transporting, lysosomal V0 subunit A2
SynonymsV-ATPase a2, Atp6n2, 8430408C20Rik, Tj6, ATP6a2, TJ6s
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.177) question?
Stock #R7977 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location124628576-124724455 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 124719986 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 810 (G810D)
Ref Sequence ENSEMBL: ENSMUSP00000039737 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037865] [ENSMUST00000197161] [ENSMUST00000198382]
PDB Structure NMR solution structure of peptide a2N(1-17) from Mus musculus V-ATPase [SOLUTION NMR]
Predicted Effect probably damaging
Transcript: ENSMUST00000037865
AA Change: G810D

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000039737
Gene: ENSMUSG00000038023
AA Change: G810D

DomainStartEndE-ValueType
Pfam:V_ATPase_I 27 842 3.3e-299 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000197161
SMART Domains Protein: ENSMUSP00000143461
Gene: ENSMUSG00000038023

DomainStartEndE-ValueType
low complexity region 63 77 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000198382
SMART Domains Protein: ENSMUSP00000143284
Gene: ENSMUSG00000038023

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:V_ATPase_I 26 178 1.5e-36 PFAM
Meta Mutation Damage Score 0.6329 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a subunit of vacuolar ATPase, a multimeric enzyme that localizes to intracellular vesicles and to the plasma membrane of specialized cells. The encoded protein is a component of the V(0) domain, which functions in proton translocation across membranes. Function of this gene is important in fetal-specific immune suppression during pregnancy. [provided by RefSeq, May 2013]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9430097D07Rik G T 2: 32,574,305 Q161K unknown Het
Acsl5 T C 19: 55,277,973 probably null Het
Adgre1 T A 17: 57,447,987 I695N possibly damaging Het
Ank2 T C 3: 126,945,707 D2176G unknown Het
Bod1l A C 5: 41,795,070 N2868K probably damaging Het
Brd7 T C 8: 88,334,141 T526A probably benign Het
C9 T A 15: 6,467,462 Y213* probably null Het
Card6 T A 15: 5,100,525 N463I probably damaging Het
Ccdc81 T C 7: 89,876,111 Y485C probably damaging Het
Celsr1 A G 15: 86,032,993 F260L probably damaging Het
Dnah8 A G 17: 30,744,524 D2304G probably damaging Het
Dnase1 A G 16: 4,037,970 D55G probably damaging Het
Ecsit C A 9: 22,073,484 R296L probably damaging Het
Entpd8 A G 2: 25,084,766 D403G probably damaging Het
Epha2 C A 4: 141,308,480 Q76K probably damaging Het
Exoc1 T A 5: 76,543,585 V252E probably damaging Het
Fmnl3 T A 15: 99,328,098 H225L possibly damaging Het
Gm4565 A C 7: 22,583,387 M2R probably benign Het
Gpr146 G T 5: 139,392,685 A81S possibly damaging Het
Heg1 C A 16: 33,720,730 S419* probably null Het
Hps5 A C 7: 46,769,051 I865S probably benign Het
Hsp90ab1 A C 17: 45,571,606 I54S probably damaging Het
Hyal4 T G 6: 24,763,866 M342R probably damaging Het
Itgal A G 7: 127,328,298 T987A possibly damaging Het
Kat6b A G 14: 21,669,863 T1428A probably benign Het
Krt9 TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC 11: 100,189,077 probably benign Het
Ldlrad4 G T 18: 68,235,669 A66S possibly damaging Het
Lmtk2 A G 5: 144,175,141 D893G probably benign Het
Myo3b A G 2: 70,330,933 T1174A probably benign Het
Naf1 CGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGA CGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGA 8: 66,860,494 probably benign Het
Nsun5 G A 5: 135,375,680 R424H probably damaging Het
Oacyl A G 18: 65,698,391 E33G probably benign Het
Olfr77 T C 9: 19,920,314 F35S possibly damaging Het
Olfr798 T C 10: 129,625,969 I31V probably benign Het
Palm C T 10: 79,793,705 probably benign Het
Papln A G 12: 83,775,382 E337G probably damaging Het
Pira2 A T 7: 3,841,697 F445Y probably benign Het
Setd1b A G 5: 123,147,680 D263G unknown Het
Slc10a7 T A 8: 78,697,214 F202I probably benign Het
Smpd3 T C 8: 106,259,894 I455V probably benign Het
Snip1 G T 4: 125,066,939 G63W probably damaging Het
Sorl1 T A 9: 41,977,561 Y1981F probably damaging Het
Tagln2 A G 1: 172,505,253 T36A probably benign Het
Tnxb T C 17: 34,710,220 S2746P possibly damaging Het
Tob2 G A 15: 81,851,480 P96L probably damaging Het
Triobp T A 15: 79,001,544 Y1816N probably damaging Het
Trpc3 A G 3: 36,644,169 I647T probably benign Het
Ttn A G 2: 76,891,561 S6600P unknown Het
Vmn1r200 A T 13: 22,395,855 Y276F possibly damaging Het
Vmn1r230 T C 17: 20,846,897 I116T probably benign Het
Vmn1r26 A T 6: 58,008,279 Y308* probably null Het
Vmn2r16 C T 5: 109,340,149 T296I probably damaging Het
Wdfy2 A G 14: 62,951,931 D283G possibly damaging Het
Other mutations in Atp6v0a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Atp6v0a2 APN 5 124721777 missense probably benign 0.19
IGL01310:Atp6v0a2 APN 5 124646028 missense probably damaging 1.00
IGL01944:Atp6v0a2 APN 5 124636105 missense probably benign 0.04
IGL02044:Atp6v0a2 APN 5 124646014 missense probably benign 0.00
IGL02400:Atp6v0a2 APN 5 124721785 missense probably benign
IGL02650:Atp6v0a2 APN 5 124712362 splice site probably benign
IGL02687:Atp6v0a2 APN 5 124714142 missense possibly damaging 0.67
IGL02965:Atp6v0a2 APN 5 124629202 missense possibly damaging 0.85
IGL03049:Atp6v0a2 APN 5 124712781 missense probably damaging 1.00
IGL03088:Atp6v0a2 APN 5 124714107 splice site probably benign
IGL03198:Atp6v0a2 APN 5 124712361 critical splice donor site probably null
alkaline UTSW 5 124719866 missense probably damaging 1.00
basic UTSW 5 124712328 nonsense probably null
electronegative UTSW 5 124646698 missense probably damaging 1.00
energizer UTSW 5 124719986 missense probably damaging 0.98
Everready UTSW 5 124641505 missense probably damaging 0.99
Lithium UTSW 5 124714145 missense probably damaging 1.00
R0128:Atp6v0a2 UTSW 5 124713184 missense probably damaging 1.00
R0594:Atp6v0a2 UTSW 5 124717982 missense probably benign 0.01
R1540:Atp6v0a2 UTSW 5 124646698 missense probably damaging 1.00
R2136:Atp6v0a2 UTSW 5 124718488 missense possibly damaging 0.78
R2921:Atp6v0a2 UTSW 5 124717917 missense possibly damaging 0.80
R2922:Atp6v0a2 UTSW 5 124717917 missense possibly damaging 0.80
R2923:Atp6v0a2 UTSW 5 124717917 missense possibly damaging 0.80
R3055:Atp6v0a2 UTSW 5 124627144 unclassified probably benign
R3889:Atp6v0a2 UTSW 5 124639265 missense probably damaging 1.00
R3893:Atp6v0a2 UTSW 5 124639265 missense probably damaging 1.00
R4013:Atp6v0a2 UTSW 5 124712796 missense probably damaging 1.00
R4490:Atp6v0a2 UTSW 5 124646734 missense probably damaging 1.00
R4791:Atp6v0a2 UTSW 5 124646727 missense probably benign 0.17
R5219:Atp6v0a2 UTSW 5 124713185 missense probably damaging 1.00
R5247:Atp6v0a2 UTSW 5 124713177 missense probably damaging 1.00
R5293:Atp6v0a2 UTSW 5 124646709 missense probably benign 0.00
R5620:Atp6v0a2 UTSW 5 124645969 nonsense probably null
R5830:Atp6v0a2 UTSW 5 124641547 missense probably damaging 1.00
R5875:Atp6v0a2 UTSW 5 124716327 missense probably benign
R5903:Atp6v0a2 UTSW 5 124712279 missense probably damaging 1.00
R6192:Atp6v0a2 UTSW 5 124629203 missense probably benign 0.01
R6425:Atp6v0a2 UTSW 5 124713130 missense probably damaging 1.00
R6752:Atp6v0a2 UTSW 5 124641514 missense probably damaging 1.00
R6919:Atp6v0a2 UTSW 5 124712161 splice site probably null
R6994:Atp6v0a2 UTSW 5 124714145 missense probably damaging 1.00
R7053:Atp6v0a2 UTSW 5 124645983 missense probably damaging 1.00
R7268:Atp6v0a2 UTSW 5 124719866 missense probably damaging 1.00
R7342:Atp6v0a2 UTSW 5 124646736 missense probably damaging 1.00
R7349:Atp6v0a2 UTSW 5 124712328 nonsense probably null
R7714:Atp6v0a2 UTSW 5 124637595 missense probably damaging 1.00
R7715:Atp6v0a2 UTSW 5 124714198 missense probably damaging 0.99
R7748:Atp6v0a2 UTSW 5 124716496 missense probably benign 0.00
R7775:Atp6v0a2 UTSW 5 124641505 missense probably damaging 0.99
R7778:Atp6v0a2 UTSW 5 124641505 missense probably damaging 0.99
R7824:Atp6v0a2 UTSW 5 124641505 missense probably damaging 0.99
R7833:Atp6v0a2 UTSW 5 124645031 missense probably damaging 1.00
R7901:Atp6v0a2 UTSW 5 124641547 missense probably damaging 1.00
R7987:Atp6v0a2 UTSW 5 124719986 missense probably damaging 0.98
R8118:Atp6v0a2 UTSW 5 124712773 missense probably damaging 0.98
R8728:Atp6v0a2 UTSW 5 124719088 missense probably benign 0.00
R8765:Atp6v0a2 UTSW 5 124716470 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGCTTATGTTTTCCAAACGGC -3'
(R):5'- TCGTAATCATTTGCATTGCACAAGC -3'

Sequencing Primer
(F):5'- AAACGGCTTTCTTTGCAGAGC -3'
(R):5'- GATGACAACTGCTGGACATTAGCTC -3'
Posted On2020-09-15