Incidental Mutation 'R7977:Atp6v0a2'
ID 650958
Institutional Source Beutler Lab
Gene Symbol Atp6v0a2
Ensembl Gene ENSMUSG00000038023
Gene Name ATPase, H+ transporting, lysosomal V0 subunit A2
Synonyms Tj6, ATP6a2, Atp6n2, 8430408C20Rik, V-ATPase a2, TJ6s
MMRRC Submission 046020-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.125) question?
Stock # R7977 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 124767117-124801519 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 124797050 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glycine to Aspartic acid at position 810 (G810D)
Ref Sequence ENSEMBL: ENSMUSP00000039737 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037865] [ENSMUST00000197161] [ENSMUST00000198382]
AlphaFold P15920
PDB Structure NMR solution structure of peptide a2N(1-17) from Mus musculus V-ATPase [SOLUTION NMR]
Predicted Effect probably damaging
Transcript: ENSMUST00000037865
AA Change: G810D

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000039737
Gene: ENSMUSG00000038023
AA Change: G810D

DomainStartEndE-ValueType
Pfam:V_ATPase_I 27 842 3.3e-299 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000197161
SMART Domains Protein: ENSMUSP00000143461
Gene: ENSMUSG00000038023

DomainStartEndE-ValueType
low complexity region 63 77 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000198382
SMART Domains Protein: ENSMUSP00000143284
Gene: ENSMUSG00000038023

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:V_ATPase_I 26 178 1.5e-36 PFAM
Meta Mutation Damage Score 0.6329 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a subunit of vacuolar ATPase, a multimeric enzyme that localizes to intracellular vesicles and to the plasma membrane of specialized cells. The encoded protein is a component of the V(0) domain, which functions in proton translocation across membranes. Function of this gene is important in fetal-specific immune suppression during pregnancy. [provided by RefSeq, May 2013]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9430097D07Rik G T 2: 32,464,317 (GRCm39) Q161K unknown Het
Acsl5 T C 19: 55,266,405 (GRCm39) probably null Het
Adgre1 T A 17: 57,754,987 (GRCm39) I695N possibly damaging Het
Ank2 T C 3: 126,739,356 (GRCm39) D2176G unknown Het
Bod1l A C 5: 41,952,413 (GRCm39) N2868K probably damaging Het
Brd7 T C 8: 89,060,769 (GRCm39) T526A probably benign Het
C9 T A 15: 6,496,943 (GRCm39) Y213* probably null Het
Card6 T A 15: 5,130,007 (GRCm39) N463I probably damaging Het
Ccdc81 T C 7: 89,525,319 (GRCm39) Y485C probably damaging Het
Celsr1 A G 15: 85,917,194 (GRCm39) F260L probably damaging Het
Dnah8 A G 17: 30,963,498 (GRCm39) D2304G probably damaging Het
Dnase1 A G 16: 3,855,834 (GRCm39) D55G probably damaging Het
Ecsit C A 9: 21,984,780 (GRCm39) R296L probably damaging Het
Entpd8 A G 2: 24,974,778 (GRCm39) D403G probably damaging Het
Epha2 C A 4: 141,035,791 (GRCm39) Q76K probably damaging Het
Exoc1 T A 5: 76,691,432 (GRCm39) V252E probably damaging Het
Fmnl3 T A 15: 99,225,979 (GRCm39) H225L possibly damaging Het
Gm4565 A C 7: 22,282,812 (GRCm39) M2R probably benign Het
Gpr146 G T 5: 139,378,440 (GRCm39) A81S possibly damaging Het
Heg1 C A 16: 33,541,100 (GRCm39) S419* probably null Het
Hps5 A C 7: 46,418,475 (GRCm39) I865S probably benign Het
Hsp90ab1 A C 17: 45,882,532 (GRCm39) I54S probably damaging Het
Hyal4 T G 6: 24,763,865 (GRCm39) M342R probably damaging Het
Itgal A G 7: 126,927,470 (GRCm39) T987A possibly damaging Het
Kat6b A G 14: 21,719,931 (GRCm39) T1428A probably benign Het
Krt9 TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC 11: 100,079,903 (GRCm39) probably benign Het
Ldlrad4 G T 18: 68,368,740 (GRCm39) A66S possibly damaging Het
Lmtk2 A G 5: 144,111,959 (GRCm39) D893G probably benign Het
Myo3b A G 2: 70,161,277 (GRCm39) T1174A probably benign Het
Naf1 CGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGA CGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGA 8: 67,313,146 (GRCm39) probably benign Het
Nsun5 G A 5: 135,404,534 (GRCm39) R424H probably damaging Het
Oacyl A G 18: 65,831,462 (GRCm39) E33G probably benign Het
Or6c66 T C 10: 129,461,838 (GRCm39) I31V probably benign Het
Or7d10 T C 9: 19,831,610 (GRCm39) F35S possibly damaging Het
Palm C T 10: 79,629,539 (GRCm39) probably benign Het
Papln A G 12: 83,822,156 (GRCm39) E337G probably damaging Het
Pira2 A T 7: 3,844,696 (GRCm39) F445Y probably benign Het
Setd1b A G 5: 123,285,743 (GRCm39) D263G unknown Het
Slc10a7 T A 8: 79,423,843 (GRCm39) F202I probably benign Het
Smpd3 T C 8: 106,986,526 (GRCm39) I455V probably benign Het
Snip1 G T 4: 124,960,732 (GRCm39) G63W probably damaging Het
Sorl1 T A 9: 41,888,857 (GRCm39) Y1981F probably damaging Het
Tagln2 A G 1: 172,332,820 (GRCm39) T36A probably benign Het
Tnxb T C 17: 34,929,194 (GRCm39) S2746P possibly damaging Het
Tob2 G A 15: 81,735,681 (GRCm39) P96L probably damaging Het
Triobp T A 15: 78,885,744 (GRCm39) Y1816N probably damaging Het
Trpc3 A G 3: 36,698,318 (GRCm39) I647T probably benign Het
Ttn A G 2: 76,721,905 (GRCm39) S6600P unknown Het
Vmn1r200 A T 13: 22,580,025 (GRCm39) Y276F possibly damaging Het
Vmn1r230 T C 17: 21,067,159 (GRCm39) I116T probably benign Het
Vmn1r26 A T 6: 57,985,264 (GRCm39) Y308* probably null Het
Vmn2r16 C T 5: 109,488,015 (GRCm39) T296I probably damaging Het
Wdfy2 A G 14: 63,189,380 (GRCm39) D283G possibly damaging Het
Other mutations in Atp6v0a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Atp6v0a2 APN 5 124,798,841 (GRCm39) missense probably benign 0.19
IGL01310:Atp6v0a2 APN 5 124,783,968 (GRCm39) missense probably damaging 1.00
IGL01944:Atp6v0a2 APN 5 124,774,043 (GRCm39) missense probably benign 0.04
IGL02044:Atp6v0a2 APN 5 124,783,954 (GRCm39) missense probably benign 0.00
IGL02400:Atp6v0a2 APN 5 124,798,849 (GRCm39) missense probably benign
IGL02650:Atp6v0a2 APN 5 124,789,426 (GRCm39) splice site probably benign
IGL02687:Atp6v0a2 APN 5 124,791,206 (GRCm39) missense possibly damaging 0.67
IGL02965:Atp6v0a2 APN 5 124,767,267 (GRCm39) missense possibly damaging 0.85
IGL03049:Atp6v0a2 APN 5 124,789,845 (GRCm39) missense probably damaging 1.00
IGL03088:Atp6v0a2 APN 5 124,791,171 (GRCm39) splice site probably benign
IGL03198:Atp6v0a2 APN 5 124,789,425 (GRCm39) critical splice donor site probably null
alkaline UTSW 5 124,796,930 (GRCm39) missense probably damaging 1.00
basic UTSW 5 124,789,392 (GRCm39) nonsense probably null
electronegative UTSW 5 124,784,638 (GRCm39) missense probably damaging 1.00
energizer UTSW 5 124,797,050 (GRCm39) missense probably damaging 0.98
Everready UTSW 5 124,779,443 (GRCm39) missense probably damaging 0.99
Lithium UTSW 5 124,791,209 (GRCm39) missense probably damaging 1.00
R0128:Atp6v0a2 UTSW 5 124,790,248 (GRCm39) missense probably damaging 1.00
R0594:Atp6v0a2 UTSW 5 124,795,046 (GRCm39) missense probably benign 0.01
R1540:Atp6v0a2 UTSW 5 124,784,638 (GRCm39) missense probably damaging 1.00
R2136:Atp6v0a2 UTSW 5 124,795,552 (GRCm39) missense possibly damaging 0.78
R2921:Atp6v0a2 UTSW 5 124,794,981 (GRCm39) missense possibly damaging 0.80
R2922:Atp6v0a2 UTSW 5 124,794,981 (GRCm39) missense possibly damaging 0.80
R2923:Atp6v0a2 UTSW 5 124,794,981 (GRCm39) missense possibly damaging 0.80
R3055:Atp6v0a2 UTSW 5 124,765,209 (GRCm39) unclassified probably benign
R3889:Atp6v0a2 UTSW 5 124,777,203 (GRCm39) missense probably damaging 1.00
R3893:Atp6v0a2 UTSW 5 124,777,203 (GRCm39) missense probably damaging 1.00
R4013:Atp6v0a2 UTSW 5 124,789,860 (GRCm39) missense probably damaging 1.00
R4490:Atp6v0a2 UTSW 5 124,784,674 (GRCm39) missense probably damaging 1.00
R4791:Atp6v0a2 UTSW 5 124,784,667 (GRCm39) missense probably benign 0.17
R5219:Atp6v0a2 UTSW 5 124,790,249 (GRCm39) missense probably damaging 1.00
R5247:Atp6v0a2 UTSW 5 124,790,241 (GRCm39) missense probably damaging 1.00
R5293:Atp6v0a2 UTSW 5 124,784,649 (GRCm39) missense probably benign 0.00
R5620:Atp6v0a2 UTSW 5 124,783,909 (GRCm39) nonsense probably null
R5830:Atp6v0a2 UTSW 5 124,779,485 (GRCm39) missense probably damaging 1.00
R5875:Atp6v0a2 UTSW 5 124,793,391 (GRCm39) missense probably benign
R5903:Atp6v0a2 UTSW 5 124,789,343 (GRCm39) missense probably damaging 1.00
R6192:Atp6v0a2 UTSW 5 124,767,268 (GRCm39) missense probably benign 0.01
R6425:Atp6v0a2 UTSW 5 124,790,194 (GRCm39) missense probably damaging 1.00
R6752:Atp6v0a2 UTSW 5 124,779,452 (GRCm39) missense probably damaging 1.00
R6919:Atp6v0a2 UTSW 5 124,789,225 (GRCm39) splice site probably null
R6994:Atp6v0a2 UTSW 5 124,791,209 (GRCm39) missense probably damaging 1.00
R7053:Atp6v0a2 UTSW 5 124,783,923 (GRCm39) missense probably damaging 1.00
R7268:Atp6v0a2 UTSW 5 124,796,930 (GRCm39) missense probably damaging 1.00
R7342:Atp6v0a2 UTSW 5 124,784,676 (GRCm39) missense probably damaging 1.00
R7349:Atp6v0a2 UTSW 5 124,789,392 (GRCm39) nonsense probably null
R7714:Atp6v0a2 UTSW 5 124,775,533 (GRCm39) missense probably damaging 1.00
R7715:Atp6v0a2 UTSW 5 124,791,262 (GRCm39) missense probably damaging 0.99
R7748:Atp6v0a2 UTSW 5 124,793,560 (GRCm39) missense probably benign 0.00
R7775:Atp6v0a2 UTSW 5 124,779,443 (GRCm39) missense probably damaging 0.99
R7778:Atp6v0a2 UTSW 5 124,779,443 (GRCm39) missense probably damaging 0.99
R7824:Atp6v0a2 UTSW 5 124,779,443 (GRCm39) missense probably damaging 0.99
R7833:Atp6v0a2 UTSW 5 124,782,969 (GRCm39) missense probably damaging 1.00
R7901:Atp6v0a2 UTSW 5 124,779,485 (GRCm39) missense probably damaging 1.00
R7987:Atp6v0a2 UTSW 5 124,797,050 (GRCm39) missense probably damaging 0.98
R8118:Atp6v0a2 UTSW 5 124,789,837 (GRCm39) missense probably damaging 0.98
R8728:Atp6v0a2 UTSW 5 124,796,152 (GRCm39) missense probably benign 0.00
R8765:Atp6v0a2 UTSW 5 124,793,534 (GRCm39) missense probably damaging 1.00
R8945:Atp6v0a2 UTSW 5 124,784,589 (GRCm39) missense probably damaging 1.00
R8971:Atp6v0a2 UTSW 5 124,797,061 (GRCm39) missense probably damaging 1.00
R9023:Atp6v0a2 UTSW 5 124,796,138 (GRCm39) missense possibly damaging 0.93
R9300:Atp6v0a2 UTSW 5 124,789,312 (GRCm39) missense probably damaging 0.98
R9360:Atp6v0a2 UTSW 5 124,767,259 (GRCm39) missense possibly damaging 0.77
R9601:Atp6v0a2 UTSW 5 124,790,257 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGCTTATGTTTTCCAAACGGC -3'
(R):5'- TCGTAATCATTTGCATTGCACAAGC -3'

Sequencing Primer
(F):5'- AAACGGCTTTCTTTGCAGAGC -3'
(R):5'- GATGACAACTGCTGGACATTAGCTC -3'
Posted On 2020-09-15