Incidental Mutation 'R7977:Pira2'
ID650964
Institutional Source Beutler Lab
Gene Symbol Pira2
Ensembl Gene ENSMUSG00000089942
Gene Namepaired-Ig-like receptor A2
Synonyms6M23
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock #R7977 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location3836812-3845051 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 3841697 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Tyrosine at position 445 (F445Y)
Ref Sequence ENSEMBL: ENSMUSP00000104255 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108615] [ENSMUST00000119469]
Predicted Effect probably benign
Transcript: ENSMUST00000108615
AA Change: F445Y

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000104255
Gene: ENSMUSG00000089942
AA Change: F445Y

DomainStartEndE-ValueType
low complexity region 8 17 N/A INTRINSIC
IG 34 118 2.39e-1 SMART
IG_like 129 220 1.94e1 SMART
IG 231 315 7.77e-1 SMART
IG 328 415 3.36e0 SMART
IG_like 435 502 3.18e0 SMART
IG 529 618 8.59e-3 SMART
low complexity region 654 663 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000119469
AA Change: F445Y

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000113857
Gene: ENSMUSG00000089942
AA Change: F445Y

DomainStartEndE-ValueType
low complexity region 8 17 N/A INTRINSIC
IG 34 118 2.39e-1 SMART
IG_like 129 220 1.94e1 SMART
IG 231 315 7.77e-1 SMART
IG 328 415 3.36e0 SMART
IG_like 435 502 3.18e0 SMART
IG 529 618 8.59e-3 SMART
low complexity region 637 646 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9430097D07Rik G T 2: 32,574,305 Q161K unknown Het
Acsl5 T C 19: 55,277,973 probably null Het
Adgre1 T A 17: 57,447,987 I695N possibly damaging Het
Ank2 T C 3: 126,945,707 D2176G unknown Het
Atp6v0a2 G A 5: 124,719,986 G810D probably damaging Het
Bod1l A C 5: 41,795,070 N2868K probably damaging Het
Brd7 T C 8: 88,334,141 T526A probably benign Het
C9 T A 15: 6,467,462 Y213* probably null Het
Card6 T A 15: 5,100,525 N463I probably damaging Het
Ccdc81 T C 7: 89,876,111 Y485C probably damaging Het
Celsr1 A G 15: 86,032,993 F260L probably damaging Het
Dnah8 A G 17: 30,744,524 D2304G probably damaging Het
Dnase1 A G 16: 4,037,970 D55G probably damaging Het
Ecsit C A 9: 22,073,484 R296L probably damaging Het
Entpd8 A G 2: 25,084,766 D403G probably damaging Het
Epha2 C A 4: 141,308,480 Q76K probably damaging Het
Exoc1 T A 5: 76,543,585 V252E probably damaging Het
Fmnl3 T A 15: 99,328,098 H225L possibly damaging Het
Gm4565 A C 7: 22,583,387 M2R probably benign Het
Gpr146 G T 5: 139,392,685 A81S possibly damaging Het
Heg1 C A 16: 33,720,730 S419* probably null Het
Hps5 A C 7: 46,769,051 I865S probably benign Het
Hsp90ab1 A C 17: 45,571,606 I54S probably damaging Het
Hyal4 T G 6: 24,763,866 M342R probably damaging Het
Itgal A G 7: 127,328,298 T987A possibly damaging Het
Kat6b A G 14: 21,669,863 T1428A probably benign Het
Krt9 TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC 11: 100,189,077 probably benign Het
Ldlrad4 G T 18: 68,235,669 A66S possibly damaging Het
Lmtk2 A G 5: 144,175,141 D893G probably benign Het
Myo3b A G 2: 70,330,933 T1174A probably benign Het
Naf1 CGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGA CGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGA 8: 66,860,494 probably benign Het
Nsun5 G A 5: 135,375,680 R424H probably damaging Het
Oacyl A G 18: 65,698,391 E33G probably benign Het
Olfr77 T C 9: 19,920,314 F35S possibly damaging Het
Olfr798 T C 10: 129,625,969 I31V probably benign Het
Palm C T 10: 79,793,705 probably benign Het
Papln A G 12: 83,775,382 E337G probably damaging Het
Setd1b A G 5: 123,147,680 D263G unknown Het
Slc10a7 T A 8: 78,697,214 F202I probably benign Het
Smpd3 T C 8: 106,259,894 I455V probably benign Het
Snip1 G T 4: 125,066,939 G63W probably damaging Het
Sorl1 T A 9: 41,977,561 Y1981F probably damaging Het
Tagln2 A G 1: 172,505,253 T36A probably benign Het
Tnxb T C 17: 34,710,220 S2746P possibly damaging Het
Tob2 G A 15: 81,851,480 P96L probably damaging Het
Triobp T A 15: 79,001,544 Y1816N probably damaging Het
Trpc3 A G 3: 36,644,169 I647T probably benign Het
Ttn A G 2: 76,891,561 S6600P unknown Het
Vmn1r200 A T 13: 22,395,855 Y276F possibly damaging Het
Vmn1r230 T C 17: 20,846,897 I116T probably benign Het
Vmn1r26 A T 6: 58,008,279 Y308* probably null Het
Vmn2r16 C T 5: 109,340,149 T296I probably damaging Het
Wdfy2 A G 14: 62,951,931 D283G possibly damaging Het
Other mutations in Pira2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01349:Pira2 APN 7 3844139 missense probably damaging 1.00
IGL01810:Pira2 APN 7 3844612 missense probably damaging 1.00
IGL03167:Pira2 APN 7 3840920 missense probably damaging 0.98
IGL03171:Pira2 APN 7 3842605 missense probably damaging 1.00
BB009:Pira2 UTSW 7 3842436 critical splice donor site probably null
BB019:Pira2 UTSW 7 3842436 critical splice donor site probably null
PIT4260001:Pira2 UTSW 7 3842170 missense probably benign
PIT4260001:Pira2 UTSW 7 3842173 missense probably benign
PIT4260001:Pira2 UTSW 7 3842174 missense probably benign
R0517:Pira2 UTSW 7 3844197 splice site probably benign
R1565:Pira2 UTSW 7 3844549 missense probably damaging 1.00
R1870:Pira2 UTSW 7 3844453 missense probably damaging 1.00
R2143:Pira2 UTSW 7 3844345 missense probably damaging 1.00
R2144:Pira2 UTSW 7 3844345 missense probably damaging 1.00
R2145:Pira2 UTSW 7 3844345 missense probably damaging 1.00
R2149:Pira2 UTSW 7 3844171 missense probably damaging 1.00
R2171:Pira2 UTSW 7 3844418 missense probably benign 0.08
R3118:Pira2 UTSW 7 3841677 nonsense probably null
R4658:Pira2 UTSW 7 3840934 missense probably damaging 1.00
R5148:Pira2 UTSW 7 3844593 missense possibly damaging 0.62
R5228:Pira2 UTSW 7 3844374 missense probably benign 0.33
R5583:Pira2 UTSW 7 3842546 missense probably benign 0.34
R5974:Pira2 UTSW 7 3841577 missense probably benign 0.27
R6120:Pira2 UTSW 7 3841554 missense probably damaging 1.00
R6122:Pira2 UTSW 7 3842446 missense probably damaging 1.00
R6392:Pira2 UTSW 7 3843902 missense possibly damaging 0.72
R6658:Pira2 UTSW 7 3842301 missense probably benign 0.00
R6790:Pira2 UTSW 7 3842443 missense probably damaging 1.00
R6990:Pira2 UTSW 7 3841068 missense probably damaging 0.99
R7336:Pira2 UTSW 7 3844345 missense probably damaging 1.00
R7597:Pira2 UTSW 7 3842461 missense probably damaging 1.00
R7768:Pira2 UTSW 7 3841697 missense probably benign
R7777:Pira2 UTSW 7 3841697 missense probably benign
R7861:Pira2 UTSW 7 3844544 missense probably damaging 1.00
R7932:Pira2 UTSW 7 3842436 critical splice donor site probably null
R7984:Pira2 UTSW 7 3841697 missense probably benign
R7985:Pira2 UTSW 7 3841697 missense probably benign
R7987:Pira2 UTSW 7 3841697 missense probably benign
R8017:Pira2 UTSW 7 3841697 missense probably benign
R8017:Pira2 UTSW 7 3841697 missense probably benign
R8019:Pira2 UTSW 7 3841697 missense probably benign
R8389:Pira2 UTSW 7 3843889 missense probably damaging 1.00
Predicted Primers
Posted On2020-09-15