Incidental Mutation 'R7977:Slc10a7'
ID650970
Institutional Source Beutler Lab
Gene Symbol Slc10a7
Ensembl Gene ENSMUSG00000031684
Gene Namesolute carrier family 10 (sodium/bile acid cotransporter family), member 7
Synonyms2410193C02Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.848) question?
Stock #R7977 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location78509346-78734003 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 78697214 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 202 (F202I)
Ref Sequence ENSEMBL: ENSMUSP00000034111 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034111] [ENSMUST00000209490] [ENSMUST00000209992] [ENSMUST00000210515] [ENSMUST00000210630] [ENSMUST00000211286]
Predicted Effect probably benign
Transcript: ENSMUST00000034111
AA Change: F202I

PolyPhen 2 Score 0.128 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000034111
Gene: ENSMUSG00000031684
AA Change: F202I

DomainStartEndE-ValueType
Pfam:SBF_like 10 324 1.9e-82 PFAM
Pfam:SBF 44 224 2.9e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000209490
AA Change: F202I

PolyPhen 2 Score 0.109 (Sensitivity: 0.93; Specificity: 0.86)
Predicted Effect probably benign
Transcript: ENSMUST00000209992
AA Change: F174I

PolyPhen 2 Score 0.109 (Sensitivity: 0.93; Specificity: 0.86)
Predicted Effect probably benign
Transcript: ENSMUST00000210515
Predicted Effect probably benign
Transcript: ENSMUST00000210630
Predicted Effect probably benign
Transcript: ENSMUST00000211286
AA Change: F202I

PolyPhen 2 Score 0.128 (Sensitivity: 0.93; Specificity: 0.86)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9430097D07Rik G T 2: 32,574,305 Q161K unknown Het
Acsl5 T C 19: 55,277,973 probably null Het
Adgre1 T A 17: 57,447,987 I695N possibly damaging Het
Ank2 T C 3: 126,945,707 D2176G unknown Het
Atp6v0a2 G A 5: 124,719,986 G810D probably damaging Het
Bod1l A C 5: 41,795,070 N2868K probably damaging Het
Brd7 T C 8: 88,334,141 T526A probably benign Het
C9 T A 15: 6,467,462 Y213* probably null Het
Card6 T A 15: 5,100,525 N463I probably damaging Het
Ccdc81 T C 7: 89,876,111 Y485C probably damaging Het
Celsr1 A G 15: 86,032,993 F260L probably damaging Het
Dnah8 A G 17: 30,744,524 D2304G probably damaging Het
Dnase1 A G 16: 4,037,970 D55G probably damaging Het
Ecsit C A 9: 22,073,484 R296L probably damaging Het
Entpd8 A G 2: 25,084,766 D403G probably damaging Het
Epha2 C A 4: 141,308,480 Q76K probably damaging Het
Exoc1 T A 5: 76,543,585 V252E probably damaging Het
Fmnl3 T A 15: 99,328,098 H225L possibly damaging Het
Gm4565 A C 7: 22,583,387 M2R probably benign Het
Gpr146 G T 5: 139,392,685 A81S possibly damaging Het
Heg1 C A 16: 33,720,730 S419* probably null Het
Hps5 A C 7: 46,769,051 I865S probably benign Het
Hsp90ab1 A C 17: 45,571,606 I54S probably damaging Het
Hyal4 T G 6: 24,763,866 M342R probably damaging Het
Itgal A G 7: 127,328,298 T987A possibly damaging Het
Kat6b A G 14: 21,669,863 T1428A probably benign Het
Krt9 TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC 11: 100,189,077 probably benign Het
Ldlrad4 G T 18: 68,235,669 A66S possibly damaging Het
Lmtk2 A G 5: 144,175,141 D893G probably benign Het
Myo3b A G 2: 70,330,933 T1174A probably benign Het
Naf1 CGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGA CGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGA 8: 66,860,494 probably benign Het
Nsun5 G A 5: 135,375,680 R424H probably damaging Het
Oacyl A G 18: 65,698,391 E33G probably benign Het
Olfr77 T C 9: 19,920,314 F35S possibly damaging Het
Olfr798 T C 10: 129,625,969 I31V probably benign Het
Palm C T 10: 79,793,705 probably benign Het
Papln A G 12: 83,775,382 E337G probably damaging Het
Pira2 A T 7: 3,841,697 F445Y probably benign Het
Setd1b A G 5: 123,147,680 D263G unknown Het
Smpd3 T C 8: 106,259,894 I455V probably benign Het
Snip1 G T 4: 125,066,939 G63W probably damaging Het
Sorl1 T A 9: 41,977,561 Y1981F probably damaging Het
Tagln2 A G 1: 172,505,253 T36A probably benign Het
Tnxb T C 17: 34,710,220 S2746P possibly damaging Het
Tob2 G A 15: 81,851,480 P96L probably damaging Het
Triobp T A 15: 79,001,544 Y1816N probably damaging Het
Trpc3 A G 3: 36,644,169 I647T probably benign Het
Ttn A G 2: 76,891,561 S6600P unknown Het
Vmn1r200 A T 13: 22,395,855 Y276F possibly damaging Het
Vmn1r230 T C 17: 20,846,897 I116T probably benign Het
Vmn1r26 A T 6: 58,008,279 Y308* probably null Het
Vmn2r16 C T 5: 109,340,149 T296I probably damaging Het
Wdfy2 A G 14: 62,951,931 D283G possibly damaging Het
Other mutations in Slc10a7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00802:Slc10a7 APN 8 78698580 splice site probably benign
IGL01589:Slc10a7 APN 8 78729740 missense probably damaging 0.98
IGL01868:Slc10a7 APN 8 78697336 splice site probably null
IGL02197:Slc10a7 APN 8 78515663 missense probably damaging 0.98
IGL02205:Slc10a7 APN 8 78697303 missense probably benign 0.04
IGL03128:Slc10a7 APN 8 78525217 missense probably damaging 1.00
R0123:Slc10a7 UTSW 8 78697158 splice site probably null
R0134:Slc10a7 UTSW 8 78697158 splice site probably null
R1973:Slc10a7 UTSW 8 78697333 critical splice donor site probably null
R2266:Slc10a7 UTSW 8 78509635 missense probably benign 0.02
R2362:Slc10a7 UTSW 8 78509632 missense probably damaging 0.99
R4756:Slc10a7 UTSW 8 78706950 critical splice donor site probably null
R5454:Slc10a7 UTSW 8 78686624 missense possibly damaging 0.71
R5753:Slc10a7 UTSW 8 78525299 critical splice donor site probably null
R6621:Slc10a7 UTSW 8 78515634 missense probably damaging 1.00
R7814:Slc10a7 UTSW 8 78698573 critical splice donor site probably null
R7987:Slc10a7 UTSW 8 78697214 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- CTGAATTCCCCAGAAGAAGAATG -3'
(R):5'- AGAGAGCGTGGAATTGCTGC -3'

Sequencing Primer
(F):5'- GAAGCTTTGAAATCCACTGTGGCC -3'
(R):5'- AACTTGTCCAGGTCGATG -3'
Posted On2020-09-15