Incidental Mutation 'R7977:Hsp90ab1'
ID650994
Institutional Source Beutler Lab
Gene Symbol Hsp90ab1
Ensembl Gene ENSMUSG00000023944
Gene Nameheat shock protein 90 alpha (cytosolic), class B member 1
SynonymsHspcb, Hsp84, Hsp90, C81438, Hsp84-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7977 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location45567775-45573271 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 45571606 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Serine at position 54 (I54S)
Ref Sequence ENSEMBL: ENSMUSP00000024739 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024739] [ENSMUST00000041353] [ENSMUST00000130406] [ENSMUST00000163966] [ENSMUST00000165127] [ENSMUST00000166469] [ENSMUST00000223987] [ENSMUST00000224905]
Predicted Effect probably damaging
Transcript: ENSMUST00000024739
AA Change: I54S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000024739
Gene: ENSMUSG00000023944
AA Change: I54S

DomainStartEndE-ValueType
low complexity region 3 13 N/A INTRINSIC
HATPase_c 35 189 3.82e-10 SMART
Pfam:HSP90 191 719 5.4e-246 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000041353
SMART Domains Protein: ENSMUSP00000037834
Gene: ENSMUSG00000037089

DomainStartEndE-ValueType
Pfam:UAA 62 363 5.1e-79 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000130406
AA Change: I54S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000119678
Gene: ENSMUSG00000023944
AA Change: I54S

DomainStartEndE-ValueType
SCOP:d1byqa_ 9 76 2e-32 SMART
PDB:1UYM|A 14 76 7e-38 PDB
Blast:HATPase_c 35 76 3e-21 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000163966
AA Change: I54S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000131601
Gene: ENSMUSG00000023944
AA Change: I54S

DomainStartEndE-ValueType
SCOP:d1byqa_ 9 85 9e-40 SMART
PDB:1UYM|A 14 85 3e-45 PDB
Blast:HATPase_c 35 85 9e-29 BLAST
low complexity region 93 107 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000165127
SMART Domains Protein: ENSMUSP00000126239
Gene: ENSMUSG00000023944

DomainStartEndE-ValueType
low complexity region 3 13 N/A INTRINSIC
Pfam:HSP90 37 161 3.8e-60 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000166469
SMART Domains Protein: ENSMUSP00000127338
Gene: ENSMUSG00000023944

DomainStartEndE-ValueType
Pfam:HSP90 4 189 1.3e-92 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000223987
Predicted Effect probably benign
Transcript: ENSMUST00000224905
Meta Mutation Damage Score 0.9465 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the heat shock protein 90 family; these proteins are involved in signal transduction, protein folding and degradation and morphological evolution. This gene encodes the constitutive form of the cytosolic 90 kDa heat-shock protein and is thought to play a role in gastric apoptosis and inflammation. Alternative splicing results in multiple transcript variants. Pseudogenes have been identified on multiple chromosomes. [provided by RefSeq, Dec 2012]
PHENOTYPE: Homozygotes for a gene-trapped null mutation exhibit placental defects including failure to form a placental labyrinth and lack of expansion of allantoic blood vessels. Mutants die around mid-gestation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9430097D07Rik G T 2: 32,574,305 Q161K unknown Het
Acsl5 T C 19: 55,277,973 probably null Het
Adgre1 T A 17: 57,447,987 I695N possibly damaging Het
Ank2 T C 3: 126,945,707 D2176G unknown Het
Atp6v0a2 G A 5: 124,719,986 G810D probably damaging Het
Bod1l A C 5: 41,795,070 N2868K probably damaging Het
Brd7 T C 8: 88,334,141 T526A probably benign Het
C9 T A 15: 6,467,462 Y213* probably null Het
Card6 T A 15: 5,100,525 N463I probably damaging Het
Ccdc81 T C 7: 89,876,111 Y485C probably damaging Het
Celsr1 A G 15: 86,032,993 F260L probably damaging Het
Dnah8 A G 17: 30,744,524 D2304G probably damaging Het
Dnase1 A G 16: 4,037,970 D55G probably damaging Het
Ecsit C A 9: 22,073,484 R296L probably damaging Het
Entpd8 A G 2: 25,084,766 D403G probably damaging Het
Epha2 C A 4: 141,308,480 Q76K probably damaging Het
Exoc1 T A 5: 76,543,585 V252E probably damaging Het
Fmnl3 T A 15: 99,328,098 H225L possibly damaging Het
Gm4565 A C 7: 22,583,387 M2R probably benign Het
Gpr146 G T 5: 139,392,685 A81S possibly damaging Het
Heg1 C A 16: 33,720,730 S419* probably null Het
Hps5 A C 7: 46,769,051 I865S probably benign Het
Hyal4 T G 6: 24,763,866 M342R probably damaging Het
Itgal A G 7: 127,328,298 T987A possibly damaging Het
Kat6b A G 14: 21,669,863 T1428A probably benign Het
Krt9 TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC 11: 100,189,077 probably benign Het
Ldlrad4 G T 18: 68,235,669 A66S possibly damaging Het
Lmtk2 A G 5: 144,175,141 D893G probably benign Het
Myo3b A G 2: 70,330,933 T1174A probably benign Het
Naf1 CGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGA CGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGA 8: 66,860,494 probably benign Het
Nsun5 G A 5: 135,375,680 R424H probably damaging Het
Oacyl A G 18: 65,698,391 E33G probably benign Het
Olfr77 T C 9: 19,920,314 F35S possibly damaging Het
Olfr798 T C 10: 129,625,969 I31V probably benign Het
Palm C T 10: 79,793,705 probably benign Het
Papln A G 12: 83,775,382 E337G probably damaging Het
Pira2 A T 7: 3,841,697 F445Y probably benign Het
Setd1b A G 5: 123,147,680 D263G unknown Het
Slc10a7 T A 8: 78,697,214 F202I probably benign Het
Smpd3 T C 8: 106,259,894 I455V probably benign Het
Snip1 G T 4: 125,066,939 G63W probably damaging Het
Sorl1 T A 9: 41,977,561 Y1981F probably damaging Het
Tagln2 A G 1: 172,505,253 T36A probably benign Het
Tnxb T C 17: 34,710,220 S2746P possibly damaging Het
Tob2 G A 15: 81,851,480 P96L probably damaging Het
Triobp T A 15: 79,001,544 Y1816N probably damaging Het
Trpc3 A G 3: 36,644,169 I647T probably benign Het
Ttn A G 2: 76,891,561 S6600P unknown Het
Vmn1r200 A T 13: 22,395,855 Y276F possibly damaging Het
Vmn1r230 T C 17: 20,846,897 I116T probably benign Het
Vmn1r26 A T 6: 58,008,279 Y308* probably null Het
Vmn2r16 C T 5: 109,340,149 T296I probably damaging Het
Wdfy2 A G 14: 62,951,931 D283G possibly damaging Het
Other mutations in Hsp90ab1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00780:Hsp90ab1 APN 17 45569564 missense probably damaging 0.96
IGL02234:Hsp90ab1 APN 17 45569735 missense probably benign 0.01
IGL02275:Hsp90ab1 APN 17 45568438 missense possibly damaging 0.76
IGL03069:Hsp90ab1 APN 17 45569028 missense possibly damaging 0.65
IGL03104:Hsp90ab1 APN 17 45571523 missense probably damaging 0.99
R0457:Hsp90ab1 UTSW 17 45568988 missense probably damaging 1.00
R0787:Hsp90ab1 UTSW 17 45569499 unclassified probably benign
R0788:Hsp90ab1 UTSW 17 45569499 unclassified probably benign
R0790:Hsp90ab1 UTSW 17 45569499 unclassified probably benign
R1142:Hsp90ab1 UTSW 17 45568974 nonsense probably null
R1738:Hsp90ab1 UTSW 17 45571806 missense probably damaging 1.00
R2109:Hsp90ab1 UTSW 17 45569328 missense probably benign 0.32
R2156:Hsp90ab1 UTSW 17 45569703 missense possibly damaging 0.82
R2509:Hsp90ab1 UTSW 17 45569341 missense probably damaging 1.00
R3686:Hsp90ab1 UTSW 17 45569288 missense probably damaging 1.00
R3695:Hsp90ab1 UTSW 17 45571477 missense probably damaging 0.98
R3700:Hsp90ab1 UTSW 17 45571514 missense possibly damaging 0.69
R4968:Hsp90ab1 UTSW 17 45571036 missense probably benign 0.05
R5809:Hsp90ab1 UTSW 17 45570649 unclassified probably benign
R6833:Hsp90ab1 UTSW 17 45570467 missense probably benign
R6834:Hsp90ab1 UTSW 17 45570467 missense probably benign
R7392:Hsp90ab1 UTSW 17 45569048 missense probably benign 0.10
R7400:Hsp90ab1 UTSW 17 45569284 missense probably benign 0.04
R7584:Hsp90ab1 UTSW 17 45570271 missense probably damaging 1.00
R7834:Hsp90ab1 UTSW 17 45571165 missense possibly damaging 0.85
R7851:Hsp90ab1 UTSW 17 45570452 missense probably benign 0.17
R7987:Hsp90ab1 UTSW 17 45571606 missense probably damaging 1.00
R8115:Hsp90ab1 UTSW 17 45569275 missense possibly damaging 0.64
R8525:Hsp90ab1 UTSW 17 45569800 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- TGGATGAAAGGCCACACAC -3'
(R):5'- TCCGCGAGTTGATCTCTAATG -3'

Sequencing Primer
(F):5'- GAGCCTCCATGAACGCCTTC -3'
(R):5'- CGCGAGTTGATCTCTAATGCTTCAG -3'
Posted On2020-09-15