Incidental Mutation 'R7977:Oacyl'
ID650996
Institutional Source Beutler Lab
Gene Symbol Oacyl
Ensembl Gene ENSMUSG00000046610
Gene NameO-acyltransferase like
Synonyms5330437I02Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R7977 (G1)
Quality Score225.009
Status Not validated
Chromosome18
Chromosomal Location65698268-65751601 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 65698391 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 33 (E33G)
Ref Sequence ENSEMBL: ENSMUSP00000110749 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115097] [ENSMUST00000117694]
Predicted Effect probably benign
Transcript: ENSMUST00000115097
AA Change: E33G

PolyPhen 2 Score 0.181 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000110749
Gene: ENSMUSG00000046610
AA Change: E33G

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
NRF 24 145 3.58e-13 SMART
Blast:NRF 152 191 1e-6 BLAST
Pfam:Acyl_transf_3 274 664 6.8e-24 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000117694
AA Change: E33G

PolyPhen 2 Score 0.766 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000113626
Gene: ENSMUSG00000046610
AA Change: E33G

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Blast:NRF 24 118 4e-14 BLAST
Pfam:Acyl_transf_3 201 591 6.7e-23 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9430097D07Rik G T 2: 32,574,305 Q161K unknown Het
Acsl5 T C 19: 55,277,973 probably null Het
Adgre1 T A 17: 57,447,987 I695N possibly damaging Het
Ank2 T C 3: 126,945,707 D2176G unknown Het
Atp6v0a2 G A 5: 124,719,986 G810D probably damaging Het
Bod1l A C 5: 41,795,070 N2868K probably damaging Het
Brd7 T C 8: 88,334,141 T526A probably benign Het
C9 T A 15: 6,467,462 Y213* probably null Het
Card6 T A 15: 5,100,525 N463I probably damaging Het
Ccdc81 T C 7: 89,876,111 Y485C probably damaging Het
Celsr1 A G 15: 86,032,993 F260L probably damaging Het
Dnah8 A G 17: 30,744,524 D2304G probably damaging Het
Dnase1 A G 16: 4,037,970 D55G probably damaging Het
Ecsit C A 9: 22,073,484 R296L probably damaging Het
Entpd8 A G 2: 25,084,766 D403G probably damaging Het
Epha2 C A 4: 141,308,480 Q76K probably damaging Het
Exoc1 T A 5: 76,543,585 V252E probably damaging Het
Fmnl3 T A 15: 99,328,098 H225L possibly damaging Het
Gm4565 A C 7: 22,583,387 M2R probably benign Het
Gpr146 G T 5: 139,392,685 A81S possibly damaging Het
Heg1 C A 16: 33,720,730 S419* probably null Het
Hps5 A C 7: 46,769,051 I865S probably benign Het
Hsp90ab1 A C 17: 45,571,606 I54S probably damaging Het
Hyal4 T G 6: 24,763,866 M342R probably damaging Het
Itgal A G 7: 127,328,298 T987A possibly damaging Het
Kat6b A G 14: 21,669,863 T1428A probably benign Het
Krt9 TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC 11: 100,189,077 probably benign Het
Ldlrad4 G T 18: 68,235,669 A66S possibly damaging Het
Lmtk2 A G 5: 144,175,141 D893G probably benign Het
Myo3b A G 2: 70,330,933 T1174A probably benign Het
Naf1 CGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGA CGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGA 8: 66,860,494 probably benign Het
Nsun5 G A 5: 135,375,680 R424H probably damaging Het
Olfr77 T C 9: 19,920,314 F35S possibly damaging Het
Olfr798 T C 10: 129,625,969 I31V probably benign Het
Palm C T 10: 79,793,705 probably benign Het
Papln A G 12: 83,775,382 E337G probably damaging Het
Pira2 A T 7: 3,841,697 F445Y probably benign Het
Setd1b A G 5: 123,147,680 D263G unknown Het
Slc10a7 T A 8: 78,697,214 F202I probably benign Het
Smpd3 T C 8: 106,259,894 I455V probably benign Het
Snip1 G T 4: 125,066,939 G63W probably damaging Het
Sorl1 T A 9: 41,977,561 Y1981F probably damaging Het
Tagln2 A G 1: 172,505,253 T36A probably benign Het
Tnxb T C 17: 34,710,220 S2746P possibly damaging Het
Tob2 G A 15: 81,851,480 P96L probably damaging Het
Triobp T A 15: 79,001,544 Y1816N probably damaging Het
Trpc3 A G 3: 36,644,169 I647T probably benign Het
Ttn A G 2: 76,891,561 S6600P unknown Het
Vmn1r200 A T 13: 22,395,855 Y276F possibly damaging Het
Vmn1r230 T C 17: 20,846,897 I116T probably benign Het
Vmn1r26 A T 6: 58,008,279 Y308* probably null Het
Vmn2r16 C T 5: 109,340,149 T296I probably damaging Het
Wdfy2 A G 14: 62,951,931 D283G possibly damaging Het
Other mutations in Oacyl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00585:Oacyl APN 18 65749640 missense possibly damaging 0.65
IGL00972:Oacyl APN 18 65725501 missense possibly damaging 0.95
IGL01970:Oacyl APN 18 65749714 missense possibly damaging 0.77
IGL02030:Oacyl APN 18 65737910 missense probably damaging 0.99
IGL02706:Oacyl APN 18 65749721 missense probably damaging 1.00
R0529:Oacyl UTSW 18 65742219 missense probably damaging 0.97
R0607:Oacyl UTSW 18 65747891 missense possibly damaging 0.61
R0724:Oacyl UTSW 18 65737825 splice site probably benign
R1138:Oacyl UTSW 18 65725450 missense probably damaging 1.00
R1482:Oacyl UTSW 18 65737972 missense probably damaging 1.00
R1551:Oacyl UTSW 18 65742209 missense probably benign 0.02
R1649:Oacyl UTSW 18 65750096 missense probably damaging 1.00
R1919:Oacyl UTSW 18 65710547 missense possibly damaging 0.87
R4271:Oacyl UTSW 18 65737967 missense probably damaging 1.00
R5443:Oacyl UTSW 18 65750182 missense probably benign
R5525:Oacyl UTSW 18 65745356 missense probably benign 0.00
R5879:Oacyl UTSW 18 65749672 missense probably damaging 1.00
R6132:Oacyl UTSW 18 65726355 missense probably damaging 1.00
R6367:Oacyl UTSW 18 65725444 missense probably damaging 1.00
R7009:Oacyl UTSW 18 65722538 nonsense probably null
R7097:Oacyl UTSW 18 65720252 missense probably benign 0.00
R7122:Oacyl UTSW 18 65720252 missense probably benign 0.00
R7132:Oacyl UTSW 18 65698409 missense probably damaging 1.00
R7260:Oacyl UTSW 18 65698367 missense probably damaging 1.00
R7403:Oacyl UTSW 18 65737895 missense probably benign 0.15
R7501:Oacyl UTSW 18 65725298 splice site probably null
R7759:Oacyl UTSW 18 65710560 missense probably damaging 1.00
R7892:Oacyl UTSW 18 65737847 missense probably benign 0.00
R7921:Oacyl UTSW 18 65725383 missense probably benign
R7987:Oacyl UTSW 18 65698391 missense probably benign 0.18
Z1177:Oacyl UTSW 18 65725347 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- AGAGGTGTCACATTTACACCC -3'
(R):5'- TACAGCCTTCTGCAGTGGTG -3'

Sequencing Primer
(F):5'- GAAATGATGGCCCTCACTT -3'
(R):5'- TCTGCAGTGGTGACCCTC -3'
Posted On2020-09-15