Incidental Mutation 'R7978:Kcnb2'
ID650999
Institutional Source Beutler Lab
Gene Symbol Kcnb2
Ensembl Gene ENSMUSG00000092083
Gene Namepotassium voltage gated channel, Shab-related subfamily, member 2
Synonyms9630047L19Rik, Kv2.2
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7978 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location15287254-15723750 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 15710613 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 570 (Y570N)
Ref Sequence ENSEMBL: ENSMUSP00000126656 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170146] [ENSMUST00000175681]
Predicted Effect probably benign
Transcript: ENSMUST00000170146
AA Change: Y570N

PolyPhen 2 Score 0.152 (Sensitivity: 0.92; Specificity: 0.87)
Predicted Effect probably benign
Transcript: ENSMUST00000175681
AA Change: Y570N

PolyPhen 2 Score 0.152 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000135382
Gene: ENSMUSG00000092083
AA Change: Y570N

DomainStartEndE-ValueType
BTB 35 144 2.59e-14 SMART
low complexity region 150 166 N/A INTRINSIC
Pfam:Ion_trans 192 428 1.7e-51 PFAM
Pfam:Ion_trans_2 336 422 2.5e-13 PFAM
Pfam:Kv2channel 471 755 7.7e-149 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated potassium (Kv) channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. Four sequence-related potassium channel genes - shaker, shaw, shab, and shal - have been identified in Drosophila, and each has been shown to have human homolog(s). This gene encodes a member of the potassium channel, voltage-gated, shab-related subfamily. This member is a delayed rectifier potassium channel. The gene is expressed in gastrointestinal smooth muscle cells. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted mutation exhibit neurological abnormalities when compared with controls, including an abnormal sleep/wake cycle, decreased exploratory and locomotor activity, and a motor strength deficit. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh A T 5: 76,888,668 I342N probably damaging Het
Alb A T 5: 90,472,073 N453I possibly damaging Het
Aox4 C A 1: 58,235,207 S384Y probably damaging Het
Ap1g1 C T 8: 109,837,767 R315* probably null Het
Cachd1 T C 4: 100,974,863 Y741H probably damaging Het
Cacna2d2 C G 9: 107,518,257 L661V probably benign Het
Ccdc90b T A 7: 92,567,713 H64Q probably damaging Het
Ccdc93 C A 1: 121,499,231 N582K possibly damaging Het
Cdh7 A G 1: 109,994,105 probably benign Het
Cnksr1 T C 4: 134,236,031 N78D probably damaging Het
Cttnbp2nl A G 3: 105,007,991 V132A probably damaging Het
Cwc25 G A 11: 97,753,218 Q230* probably null Het
Dsel G A 1: 111,859,719 R1029* probably null Het
Dspp TGACAGCAGTGACAGCAGCGACAGCAGCGACAGCAGTGACAGCAGCGACAGCAGCGACAGCAGTGACAGCAGCGACAGCAGCAACAGCAGTGACAGCAG TGACAGCAGTGACAGCAGCGACAGCAGCGACAGCAGTGACAGCAGCGACAGCAGCAACAGCAGTGACAGCAG 5: 104,178,361 probably benign Het
Fam120a T C 13: 48,902,274 Y646C probably damaging Het
Hltf T C 3: 20,092,804 W576R probably damaging Het
Hmcn2 A G 2: 31,389,347 N1787S probably benign Het
Ift122 A G 6: 115,920,352 E904G probably benign Het
Igkv17-121 C T 6: 68,036,822 T2I unknown Het
Ino80 T G 2: 119,439,393 R590S possibly damaging Het
Intu T A 3: 40,697,639 I842N probably damaging Het
Itgae A T 11: 73,134,087 T1015S probably damaging Het
Kank1 GCGAACG GCG 19: 25,411,205 probably null Het
Kcna10 A G 3: 107,194,347 E98G probably damaging Het
Kmt2c T C 5: 25,359,678 I923V probably benign Het
Kptn A G 7: 16,125,772 D307G probably damaging Het
Myo3b T C 2: 70,253,114 Y704H probably damaging Het
Olfr103 A G 17: 37,336,501 F244L probably benign Het
Olfr1186 T A 2: 88,525,670 L29* probably null Het
Olfr1312 T C 2: 112,042,178 T285A possibly damaging Het
Olfr48 A T 2: 89,844,267 C235* probably null Het
Pmel G A 10: 128,715,950 V218M probably damaging Het
Prkar2b T C 12: 31,963,025 H364R possibly damaging Het
Psd4 T C 2: 24,404,855 F809S probably damaging Het
Rabgap1l A G 1: 160,251,268 S59P Het
Rgr A G 14: 37,044,688 F134L probably benign Het
Rspry1 G T 8: 94,623,125 R47L probably damaging Het
Scd3 G T 19: 44,234,249 E113* probably null Het
Slc22a12 G A 19: 6,536,908 A476V possibly damaging Het
Smg1 T C 7: 118,193,655 E560G unknown Het
Snx3 A G 10: 42,502,350 D7G probably benign Het
Son AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG 16: 91,660,334 probably benign Het
Tbc1d12 A G 19: 38,916,841 M667V probably benign Het
Tbc1d30 A T 10: 121,306,199 V81E probably damaging Het
Tbc1d9 A T 8: 83,239,954 I395F probably damaging Het
Tes C A 6: 17,096,323 N103K probably benign Het
Tet2 T C 3: 133,487,665 Y336C possibly damaging Het
Tgfbr3 T C 5: 107,139,860 N491S probably damaging Het
Tomt T C 7: 101,900,347 I245V probably damaging Het
Trbc1 T C 6: 41,538,302 L28P Het
Trp63 T C 16: 25,820,686 V208A unknown Het
Ttll8 G T 15: 88,915,362 N625K probably benign Het
Ush2a T A 1: 188,399,938 W786R probably benign Het
Vmn2r97 A T 17: 18,947,592 I703F probably damaging Het
Other mutations in Kcnb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00425:Kcnb2 APN 1 15711012 missense probably benign 0.02
IGL01321:Kcnb2 APN 1 15312923 missense probably benign 0.09
IGL01353:Kcnb2 APN 1 15710824 missense probably benign 0.02
IGL01990:Kcnb2 APN 1 15312954 missense probably benign 0.19
IGL02008:Kcnb2 APN 1 15710809 missense probably benign 0.00
IGL02120:Kcnb2 APN 1 15709861 missense probably damaging 0.98
IGL02370:Kcnb2 APN 1 15710935 missense probably benign
IGL02526:Kcnb2 APN 1 15710755 missense probably damaging 1.00
IGL02859:Kcnb2 APN 1 15710506 missense probably damaging 1.00
IGL03039:Kcnb2 APN 1 15711211 missense probably benign
IGL03144:Kcnb2 APN 1 15709888 missense probably damaging 1.00
F5770:Kcnb2 UTSW 1 15710091 missense probably benign 0.07
PIT4131001:Kcnb2 UTSW 1 15312976 missense possibly damaging 0.92
R0266:Kcnb2 UTSW 1 15712913 unclassified probably benign
R0538:Kcnb2 UTSW 1 15712884 unclassified probably benign
R0611:Kcnb2 UTSW 1 15710440 missense probably benign 0.07
R1542:Kcnb2 UTSW 1 15710788 missense probably benign 0.01
R1732:Kcnb2 UTSW 1 15709755 missense probably benign 0.02
R1995:Kcnb2 UTSW 1 15709766 missense possibly damaging 0.66
R2166:Kcnb2 UTSW 1 15711316 missense possibly damaging 0.82
R2444:Kcnb2 UTSW 1 15709567 missense probably benign
R3025:Kcnb2 UTSW 1 15710835 missense possibly damaging 0.87
R3886:Kcnb2 UTSW 1 15710415 missense probably damaging 1.00
R5010:Kcnb2 UTSW 1 15312962 missense probably benign 0.09
R5039:Kcnb2 UTSW 1 15709500 missense probably damaging 1.00
R5096:Kcnb2 UTSW 1 15710844 missense probably benign 0.45
R5444:Kcnb2 UTSW 1 15711492 missense probably benign
R5926:Kcnb2 UTSW 1 15313011 missense probably benign 0.01
R6010:Kcnb2 UTSW 1 15710566 missense possibly damaging 0.85
R6371:Kcnb2 UTSW 1 15711212 missense probably benign
R6724:Kcnb2 UTSW 1 15710440 missense probably damaging 1.00
R6981:Kcnb2 UTSW 1 15710256 missense probably damaging 1.00
R7043:Kcnb2 UTSW 1 15312926 missense probably benign
R7352:Kcnb2 UTSW 1 15710611 missense probably benign
R7419:Kcnb2 UTSW 1 15711027 missense possibly damaging 0.94
R7425:Kcnb2 UTSW 1 15709807 missense probably damaging 1.00
R7606:Kcnb2 UTSW 1 15312840 missense probably damaging 1.00
R7983:Kcnb2 UTSW 1 15312780 missense probably damaging 0.98
R8115:Kcnb2 UTSW 1 15711627 makesense probably null
R8156:Kcnb2 UTSW 1 15710056 missense probably damaging 1.00
R8408:Kcnb2 UTSW 1 15711553 missense probably damaging 1.00
R8439:Kcnb2 UTSW 1 15312710 missense probably damaging 1.00
R8726:Kcnb2 UTSW 1 15710652 missense probably benign 0.00
R8738:Kcnb2 UTSW 1 15710424 missense probably benign 0.07
V7580:Kcnb2 UTSW 1 15710091 missense probably benign 0.07
V7581:Kcnb2 UTSW 1 15710091 missense probably benign 0.07
V7582:Kcnb2 UTSW 1 15710091 missense probably benign 0.07
V7583:Kcnb2 UTSW 1 15710091 missense probably benign 0.07
Z1088:Kcnb2 UTSW 1 15710091 missense probably benign 0.03
Z1088:Kcnb2 UTSW 1 15711028 missense probably benign 0.01
Z1177:Kcnb2 UTSW 1 15710958 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- TGTCAGAAACGAGCTCCAAC -3'
(R):5'- GGGAACTTCATCTGCAAATGAGAG -3'

Sequencing Primer
(F):5'- CAAATCTTACGAGAATAAGTACCAGG -3'
(R):5'- AGGCAGAGGGTGGTGGC -3'
Posted On2020-09-15