Incidental Mutation 'R7978:Myo3b'
ID651008
Institutional Source Beutler Lab
Gene Symbol Myo3b
Ensembl Gene ENSMUSG00000042064
Gene Namemyosin IIIB
SynonymsA430065P19Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7978 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location70039126-70429198 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 70253114 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 704 (Y704H)
Ref Sequence ENSEMBL: ENSMUSP00000055362 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060208] [ENSMUST00000112243]
Predicted Effect probably damaging
Transcript: ENSMUST00000060208
AA Change: Y704H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000055362
Gene: ENSMUSG00000042064
AA Change: Y704H

DomainStartEndE-ValueType
S_TKc 43 309 2.24e-85 SMART
MYSc 353 1075 6.61e-260 SMART
IQ 1075 1097 9.51e1 SMART
IQ 1102 1124 1.73e-5 SMART
low complexity region 1319 1324 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112243
AA Change: Y676H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107862
Gene: ENSMUSG00000042064
AA Change: Y676H

DomainStartEndE-ValueType
S_TKc 15 281 2.24e-85 SMART
MYSc 325 1047 6.61e-260 SMART
IQ 1047 1069 9.51e1 SMART
IQ 1074 1096 1.73e-5 SMART
low complexity region 1291 1296 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the class III myosins. Myosins are ATPases, activated by actin, that move along actin filaments in the cell. This class of myosins are characterized by an amino-terminal kinase domain and shown to be present in photoreceptors. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Mar 2014]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh A T 5: 76,888,668 I342N probably damaging Het
Alb A T 5: 90,472,073 N453I possibly damaging Het
Aox4 C A 1: 58,235,207 S384Y probably damaging Het
Ap1g1 C T 8: 109,837,767 R315* probably null Het
Cachd1 T C 4: 100,974,863 Y741H probably damaging Het
Cacna2d2 C G 9: 107,518,257 L661V probably benign Het
Ccdc90b T A 7: 92,567,713 H64Q probably damaging Het
Ccdc93 C A 1: 121,499,231 N582K possibly damaging Het
Cdh7 A G 1: 109,994,105 probably benign Het
Cnksr1 T C 4: 134,236,031 N78D probably damaging Het
Cttnbp2nl A G 3: 105,007,991 V132A probably damaging Het
Cwc25 G A 11: 97,753,218 Q230* probably null Het
Dsel G A 1: 111,859,719 R1029* probably null Het
Dspp TGACAGCAGTGACAGCAGCGACAGCAGCGACAGCAGTGACAGCAGCGACAGCAGCGACAGCAGTGACAGCAGCGACAGCAGCAACAGCAGTGACAGCAG TGACAGCAGTGACAGCAGCGACAGCAGCGACAGCAGTGACAGCAGCGACAGCAGCAACAGCAGTGACAGCAG 5: 104,178,361 probably benign Het
Fam120a T C 13: 48,902,274 Y646C probably damaging Het
Hltf T C 3: 20,092,804 W576R probably damaging Het
Hmcn2 A G 2: 31,389,347 N1787S probably benign Het
Ift122 A G 6: 115,920,352 E904G probably benign Het
Igkv17-121 C T 6: 68,036,822 T2I unknown Het
Ino80 T G 2: 119,439,393 R590S possibly damaging Het
Intu T A 3: 40,697,639 I842N probably damaging Het
Itgae A T 11: 73,134,087 T1015S probably damaging Het
Kank1 GCGAACG GCG 19: 25,411,205 probably null Het
Kcna10 A G 3: 107,194,347 E98G probably damaging Het
Kcnb2 T A 1: 15,710,613 Y570N probably benign Het
Kmt2c T C 5: 25,359,678 I923V probably benign Het
Kptn A G 7: 16,125,772 D307G probably damaging Het
Olfr103 A G 17: 37,336,501 F244L probably benign Het
Olfr1186 T A 2: 88,525,670 L29* probably null Het
Olfr1312 T C 2: 112,042,178 T285A possibly damaging Het
Olfr48 A T 2: 89,844,267 C235* probably null Het
Pmel G A 10: 128,715,950 V218M probably damaging Het
Prkar2b T C 12: 31,963,025 H364R possibly damaging Het
Psd4 T C 2: 24,404,855 F809S probably damaging Het
Rabgap1l A G 1: 160,251,268 S59P Het
Rgr A G 14: 37,044,688 F134L probably benign Het
Rspry1 G T 8: 94,623,125 R47L probably damaging Het
Scd3 G T 19: 44,234,249 E113* probably null Het
Slc22a12 G A 19: 6,536,908 A476V possibly damaging Het
Smg1 T C 7: 118,193,655 E560G unknown Het
Snx3 A G 10: 42,502,350 D7G probably benign Het
Son AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG 16: 91,660,334 probably benign Het
Tbc1d12 A G 19: 38,916,841 M667V probably benign Het
Tbc1d30 A T 10: 121,306,199 V81E probably damaging Het
Tbc1d9 A T 8: 83,239,954 I395F probably damaging Het
Tes C A 6: 17,096,323 N103K probably benign Het
Tet2 T C 3: 133,487,665 Y336C possibly damaging Het
Tgfbr3 T C 5: 107,139,860 N491S probably damaging Het
Tomt T C 7: 101,900,347 I245V probably damaging Het
Trbc1 T C 6: 41,538,302 L28P Het
Trp63 T C 16: 25,820,686 V208A unknown Het
Ttll8 G T 15: 88,915,362 N625K probably benign Het
Ush2a T A 1: 188,399,938 W786R probably benign Het
Vmn2r97 A T 17: 18,947,592 I703F probably damaging Het
Other mutations in Myo3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00736:Myo3b APN 2 70105645 splice site probably benign
IGL00959:Myo3b APN 2 70314292 missense probably damaging 1.00
IGL01069:Myo3b APN 2 70245391 missense probably benign 0.22
IGL01116:Myo3b APN 2 70289386 missense probably damaging 1.00
IGL02097:Myo3b APN 2 70238829 missense probably damaging 1.00
IGL02220:Myo3b APN 2 70289579 splice site probably benign
IGL02553:Myo3b APN 2 70095224 missense probably benign 0.00
IGL02557:Myo3b APN 2 70255319 missense probably benign 0.16
IGL02648:Myo3b APN 2 70105372 splice site probably benign
IGL02902:Myo3b APN 2 70289401 missense probably benign 0.36
IGL02981:Myo3b APN 2 70108625 missense probably damaging 1.00
IGL03030:Myo3b APN 2 70426816 splice site probably benign
IGL03031:Myo3b APN 2 70255377 missense possibly damaging 0.64
IGL03068:Myo3b APN 2 70426816 splice site probably benign
IGL03078:Myo3b APN 2 70286991 missense probably damaging 1.00
IGL03224:Myo3b APN 2 70349939 missense probably benign
IGL03329:Myo3b APN 2 70254459 missense probably damaging 1.00
R0079:Myo3b UTSW 2 70095158 missense possibly damaging 0.58
R0226:Myo3b UTSW 2 70217166 missense probably benign 0.00
R0238:Myo3b UTSW 2 70105425 missense probably benign 0.00
R0238:Myo3b UTSW 2 70105425 missense probably benign 0.00
R0239:Myo3b UTSW 2 70105425 missense probably benign 0.00
R0239:Myo3b UTSW 2 70105425 missense probably benign 0.00
R0313:Myo3b UTSW 2 70348959 nonsense probably null
R0331:Myo3b UTSW 2 70095261 missense probably damaging 1.00
R0371:Myo3b UTSW 2 70252960 splice site probably benign
R0442:Myo3b UTSW 2 70238961 critical splice donor site probably null
R0964:Myo3b UTSW 2 70426849 missense probably damaging 1.00
R1217:Myo3b UTSW 2 70330880 missense probably benign 0.02
R1429:Myo3b UTSW 2 70253007 missense probably damaging 0.97
R1460:Myo3b UTSW 2 70232454 missense probably benign 0.31
R1617:Myo3b UTSW 2 70281218 missense probably benign 0.00
R1628:Myo3b UTSW 2 70286962 missense probably benign 0.01
R1708:Myo3b UTSW 2 70245385 nonsense probably null
R1940:Myo3b UTSW 2 70258075 missense probably benign 0.01
R2407:Myo3b UTSW 2 70255253 missense probably damaging 1.00
R3081:Myo3b UTSW 2 70256583 splice site probably benign
R3687:Myo3b UTSW 2 70245314 missense probably benign
R3745:Myo3b UTSW 2 70234485 splice site probably benign
R4011:Myo3b UTSW 2 70096376 missense probably benign 0.15
R4074:Myo3b UTSW 2 70289464 missense probably damaging 1.00
R4419:Myo3b UTSW 2 70096362 missense probably damaging 1.00
R4496:Myo3b UTSW 2 70254404 missense probably benign
R4539:Myo3b UTSW 2 70039147 start codon destroyed probably null 0.00
R4643:Myo3b UTSW 2 70238842 missense possibly damaging 0.49
R4657:Myo3b UTSW 2 70238899 missense possibly damaging 0.95
R4807:Myo3b UTSW 2 70105712 missense probably damaging 1.00
R4849:Myo3b UTSW 2 70244909 missense probably damaging 0.98
R4997:Myo3b UTSW 2 70258083 missense possibly damaging 0.49
R5008:Myo3b UTSW 2 70258068 missense probably damaging 0.99
R5070:Myo3b UTSW 2 70253112 missense probably damaging 1.00
R5072:Myo3b UTSW 2 70095249 missense possibly damaging 0.96
R5082:Myo3b UTSW 2 70258030 missense probably benign 0.01
R5103:Myo3b UTSW 2 70096403 missense probably benign 0.08
R5109:Myo3b UTSW 2 70095293 missense possibly damaging 0.66
R5304:Myo3b UTSW 2 70426888 missense probably damaging 0.97
R5396:Myo3b UTSW 2 70126985 missense probably damaging 0.99
R5400:Myo3b UTSW 2 70105380 missense probably damaging 1.00
R5468:Myo3b UTSW 2 70234441 missense probably benign 0.00
R5620:Myo3b UTSW 2 70238910 missense probably benign 0.04
R5646:Myo3b UTSW 2 70314430 missense probably damaging 0.97
R5729:Myo3b UTSW 2 70105739 missense probably damaging 1.00
R5943:Myo3b UTSW 2 70286941 missense probably benign 0.03
R5971:Myo3b UTSW 2 70238899 missense possibly damaging 0.95
R6091:Myo3b UTSW 2 70238769 missense probably benign 0.00
R6138:Myo3b UTSW 2 70238899 missense possibly damaging 0.95
R6164:Myo3b UTSW 2 70245410 critical splice donor site probably null
R6177:Myo3b UTSW 2 70313363 missense probably benign 0.00
R6421:Myo3b UTSW 2 70313356 missense probably benign 0.02
R6478:Myo3b UTSW 2 70348960 missense probably benign
R6606:Myo3b UTSW 2 70232485 missense possibly damaging 0.94
R6752:Myo3b UTSW 2 70289512 missense probably damaging 1.00
R6982:Myo3b UTSW 2 70426065 missense probably benign 0.02
R6997:Myo3b UTSW 2 70126985 missense probably damaging 0.99
R7032:Myo3b UTSW 2 70095264 missense probably damaging 0.98
R7038:Myo3b UTSW 2 70095208 missense probably benign 0.00
R7062:Myo3b UTSW 2 70217157 missense probably benign 0.00
R7537:Myo3b UTSW 2 70217169 missense probably benign 0.01
R7861:Myo3b UTSW 2 70108688 missense probably damaging 1.00
R7955:Myo3b UTSW 2 70095279 missense probably benign 0.37
R7977:Myo3b UTSW 2 70330933 missense probably benign
R7987:Myo3b UTSW 2 70330933 missense probably benign
U15987:Myo3b UTSW 2 70238899 missense possibly damaging 0.95
X0025:Myo3b UTSW 2 70232403 missense probably benign 0.00
X0065:Myo3b UTSW 2 70257969 missense probably damaging 1.00
Z1177:Myo3b UTSW 2 70096361 missense probably damaging 1.00
Z1177:Myo3b UTSW 2 70258027 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ACATGTCTAGGACCATACTCACTC -3'
(R):5'- TGGTTCCCACTGATGCTCTAAAC -3'

Sequencing Primer
(F):5'- GGACCATACTCACTCTGTGTTCCAG -3'
(R):5'- CACTGATGCTCTAAACGATGAAAG -3'
Posted On2020-09-15