Mutagenetix > Incidental Mutation

Incidental Mutation 'R7978:Rspry1'

651034

Institutional Source

Beutler Lab

Gene Symbol

Rspry1

Ensembl Gene

ENSMUSG00000050079

Gene Name

ring finger and SPRY domain containing 1

Synonyms

4930470D19Rik

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.499) question?

Stock #

R7978 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

94601937-94660275 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 94623125 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Leucine at position 47 (R47L)

Ref Sequence

ENSEMBL: ENSMUSP00000057275 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000060389] [ENSMUST00000121101] [ENSMUST00000211983] [ENSMUST00000212729]

AlphaFold

Q8BVR6

Predicted Effect

probably damaging
Transcript: ENSMUST00000060389
AA Change: R47L

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000057275
Gene: ENSMUSG00000050079
AA Change: R47L

Domain	Start	End	E-Value	Type
signal peptide	1	16	N/A	INTRINSIC
low complexity region	30	39	N/A	INTRINSIC
low complexity region	74	95	N/A	INTRINSIC
SPRY	358	482	2.94e-26	SMART
RING	527	561	3.93e-3	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000121101
AA Change: R47L

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000112482
Gene: ENSMUSG00000050079
AA Change: R47L

Domain	Start	End	E-Value	Type
signal peptide	1	16	N/A	INTRINSIC
low complexity region	30	39	N/A	INTRINSIC
low complexity region	74	95	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000211983
AA Change: R47L

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)

Predicted Effect

probably benign
Transcript: ENSMUST00000212729

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a glycoprotein that contains a RING-type zinc finger domain and an SPRY domain of unknown function. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Feb 2015]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aasdh	A	T	5: 76,888,668	I342N	probably damaging	Het
Alb	A	T	5: 90,472,073	N453I	possibly damaging	Het
Aox4	C	A	1: 58,235,207	S384Y	probably damaging	Het
Ap1g1	C	T	8: 109,837,767	R315*	probably null	Het
Cachd1	T	C	4: 100,974,863	Y741H	probably damaging	Het
Cacna2d2	C	G	9: 107,518,257	L661V	probably benign	Het
Ccdc90b	T	A	7: 92,567,713	H64Q	probably damaging	Het
Ccdc93	C	A	1: 121,499,231	N582K	possibly damaging	Het
Cdh7	A	G	1: 109,994,105		probably benign	Het
Cnksr1	T	C	4: 134,236,031	N78D	probably damaging	Het
Cttnbp2nl	A	G	3: 105,007,991	V132A	probably damaging	Het
Cwc25	G	A	11: 97,753,218	Q230*	probably null	Het
Dsel	G	A	1: 111,859,719	R1029*	probably null	Het
Dspp	TGACAGCAGTGACAGCAGCGACAGCAGCGACAGCAGTGACAGCAGCGACAGCAGCGACAGCAGTGACAGCAGCGACAGCAGCAACAGCAGTGACAGCAG	TGACAGCAGTGACAGCAGCGACAGCAGCGACAGCAGTGACAGCAGCGACAGCAGCAACAGCAGTGACAGCAG	5: 104,178,361		probably benign	Het
Fam120a	T	C	13: 48,902,274	Y646C	probably damaging	Het
Hltf	T	C	3: 20,092,804	W576R	probably damaging	Het
Hmcn2	A	G	2: 31,389,347	N1787S	probably benign	Het
Ift122	A	G	6: 115,920,352	E904G	probably benign	Het
Igkv17-121	C	T	6: 68,036,822	T2I	unknown	Het
Ino80	T	G	2: 119,439,393	R590S	possibly damaging	Het
Intu	T	A	3: 40,697,639	I842N	probably damaging	Het
Itgae	A	T	11: 73,134,087	T1015S	probably damaging	Het
Kank1	GCGAACG	GCG	19: 25,411,205		probably null	Het
Kcna10	A	G	3: 107,194,347	E98G	probably damaging	Het
Kcnb2	T	A	1: 15,710,613	Y570N	probably benign	Het
Kmt2c	T	C	5: 25,359,678	I923V	probably benign	Het
Kptn	A	G	7: 16,125,772	D307G	probably damaging	Het
Myo3b	T	C	2: 70,253,114	Y704H	probably damaging	Het
Olfr103	A	G	17: 37,336,501	F244L	probably benign	Het
Olfr1186	T	A	2: 88,525,670	L29*	probably null	Het
Olfr1312	T	C	2: 112,042,178	T285A	possibly damaging	Het
Olfr48	A	T	2: 89,844,267	C235*	probably null	Het
Pmel	G	A	10: 128,715,950	V218M	probably damaging	Het
Prkar2b	T	C	12: 31,963,025	H364R	possibly damaging	Het
Psd4	T	C	2: 24,404,855	F809S	probably damaging	Het
Rabgap1l	A	G	1: 160,251,268	S59P		Het
Rgr	A	G	14: 37,044,688	F134L	probably benign	Het
Scd3	G	T	19: 44,234,249	E113*	probably null	Het
Slc22a12	G	A	19: 6,536,908	A476V	possibly damaging	Het
Smg1	T	C	7: 118,193,655	E560G	unknown	Het
Snx3	A	G	10: 42,502,350	D7G	probably benign	Het
Son	AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG	AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG	16: 91,660,334		probably benign	Het
Tbc1d12	A	G	19: 38,916,841	M667V	probably benign	Het
Tbc1d30	A	T	10: 121,306,199	V81E	probably damaging	Het
Tbc1d9	A	T	8: 83,239,954	I395F	probably damaging	Het
Tes	C	A	6: 17,096,323	N103K	probably benign	Het
Tet2	T	C	3: 133,487,665	Y336C	possibly damaging	Het
Tgfbr3	T	C	5: 107,139,860	N491S	probably damaging	Het
Tomt	T	C	7: 101,900,347	I245V	probably damaging	Het
Trbc1	T	C	6: 41,538,302	L28P		Het
Trp63	T	C	16: 25,820,686	V208A	unknown	Het
Ttll8	G	T	15: 88,915,362	N625K	probably benign	Het
Ush2a	T	A	1: 188,399,938	W786R	probably benign	Het
Vmn2r97	A	T	17: 18,947,592	I703F	probably damaging	Het

Other mutations in Rspry1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00158:Rspry1	APN	8	94622986	start codon destroyed	probably null	0.89
IGL00158:Rspry1	APN	8	94622980	intron	probably benign
IGL01141:Rspry1	APN	8	94649855	missense	probably benign	0.00
IGL01860:Rspry1	APN	8	94649816	missense	probably benign	0.00
IGL02174:Rspry1	APN	8	94633140	missense	possibly damaging	0.84
IGL02819:Rspry1	APN	8	94654256	missense	probably benign	0.42
IGL02926:Rspry1	APN	8	94649811	missense	probably damaging	1.00
IGL03366:Rspry1	APN	8	94650334	missense	probably benign	0.00
R0570:Rspry1	UTSW	8	94629792	missense	probably damaging	1.00
R1833:Rspry1	UTSW	8	94635488	missense	probably damaging	1.00
R1988:Rspry1	UTSW	8	94632054	critical splice acceptor site	probably null
R2444:Rspry1	UTSW	8	94623107	missense	probably damaging	1.00
R3623:Rspry1	UTSW	8	94649777	missense	probably damaging	1.00
R3624:Rspry1	UTSW	8	94649777	missense	probably damaging	1.00
R4275:Rspry1	UTSW	8	94649761	missense	probably benign	0.00
R4888:Rspry1	UTSW	8	94658789	missense	probably benign	0.19
R5026:Rspry1	UTSW	8	94650303	missense	probably damaging	1.00
R5310:Rspry1	UTSW	8	94623185	missense	probably benign
R5374:Rspry1	UTSW	8	94623008	missense	probably benign	0.00
R5374:Rspry1	UTSW	8	94654264	missense	probably benign	0.38
R5387:Rspry1	UTSW	8	94638286	missense	possibly damaging	0.95
R5517:Rspry1	UTSW	8	94636760	splice site	probably null
R5631:Rspry1	UTSW	8	94629078	start codon destroyed	possibly damaging	0.79
R5653:Rspry1	UTSW	8	94636611	splice site	probably null
R6065:Rspry1	UTSW	8	94622987	start codon destroyed	probably null	0.98
R6220:Rspry1	UTSW	8	94658750	missense	probably damaging	1.00
R6276:Rspry1	UTSW	8	94623258	missense	probably damaging	1.00
R6821:Rspry1	UTSW	8	94635431	nonsense	probably null
R7390:Rspry1	UTSW	8	94623185	missense	probably benign
R7460:Rspry1	UTSW	8	94650335	missense	probably benign	0.00
R7644:Rspry1	UTSW	8	94658768	missense	probably benign	0.00
R7717:Rspry1	UTSW	8	94623122	missense	probably damaging	1.00
R7768:Rspry1	UTSW	8	94629841	missense	probably damaging	1.00
R7940:Rspry1	UTSW	8	94623007	missense	probably benign	0.22
R8087:Rspry1	UTSW	8	94654297	missense	probably benign	0.04
R8174:Rspry1	UTSW	8	94649822	missense	probably damaging	0.97
R8326:Rspry1	UTSW	8	94639589	missense	probably damaging	1.00
R8676:Rspry1	UTSW	8	94632119	missense	probably benign	0.01
R8715:Rspry1	UTSW	8	94623260	missense	probably damaging	0.98
R8869:Rspry1	UTSW	8	94633152	missense	probably damaging	0.97
R9253:Rspry1	UTSW	8	94622993	missense	probably damaging	1.00
R9281:Rspry1	UTSW	8	94636631	missense	probably damaging	1.00
X0010:Rspry1	UTSW	8	94629801	missense	possibly damaging	0.76

Predicted Primers

PCR Primer
(F):5'- AGCTGCTTGACCTTCTCCAG -3'
(R):5'- GTATTACCGCCAGTGTGTCCAG -3'

Sequencing Primer
(F):5'- TCCACATTATGAAAACAGTACTCGG -3'
(R):5'- GCACTAACCCATCCACATTTTG -3'

Posted On

2020-09-15