Incidental Mutation 'R7978:Rspry1'
ID 651034
Institutional Source Beutler Lab
Gene Symbol Rspry1
Ensembl Gene ENSMUSG00000050079
Gene Name ring finger and SPRY domain containing 1
Synonyms 4930470D19Rik
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.379) question?
Stock # R7978 (G1)
Quality Score 225.009
Status Not validated
Chromosome 8
Chromosomal Location 95328569-95386905 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 95349753 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Leucine at position 47 (R47L)
Ref Sequence ENSEMBL: ENSMUSP00000057275 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060389] [ENSMUST00000121101] [ENSMUST00000211983] [ENSMUST00000212729]
AlphaFold Q8BVR6
Predicted Effect probably damaging
Transcript: ENSMUST00000060389
AA Change: R47L

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000057275
Gene: ENSMUSG00000050079
AA Change: R47L

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
low complexity region 30 39 N/A INTRINSIC
low complexity region 74 95 N/A INTRINSIC
SPRY 358 482 2.94e-26 SMART
RING 527 561 3.93e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000121101
AA Change: R47L

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000112482
Gene: ENSMUSG00000050079
AA Change: R47L

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
low complexity region 30 39 N/A INTRINSIC
low complexity region 74 95 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000211983
AA Change: R47L

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
Predicted Effect probably benign
Transcript: ENSMUST00000212729
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a glycoprotein that contains a RING-type zinc finger domain and an SPRY domain of unknown function. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Feb 2015]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh A T 5: 77,036,515 (GRCm39) I342N probably damaging Het
Alb A T 5: 90,619,932 (GRCm39) N453I possibly damaging Het
Aox4 C A 1: 58,274,366 (GRCm39) S384Y probably damaging Het
Ap1g1 C T 8: 110,564,399 (GRCm39) R315* probably null Het
Cachd1 T C 4: 100,832,060 (GRCm39) Y741H probably damaging Het
Cacna2d2 C G 9: 107,395,456 (GRCm39) L661V probably benign Het
Ccdc90b T A 7: 92,216,921 (GRCm39) H64Q probably damaging Het
Ccdc93 C A 1: 121,426,960 (GRCm39) N582K possibly damaging Het
Cdh20 A G 1: 109,921,835 (GRCm39) probably benign Het
Cnksr1 T C 4: 133,963,342 (GRCm39) N78D probably damaging Het
Cttnbp2nl A G 3: 104,915,307 (GRCm39) V132A probably damaging Het
Cwc25 G A 11: 97,644,044 (GRCm39) Q230* probably null Het
Dsel G A 1: 111,787,449 (GRCm39) R1029* probably null Het
Dspp TGACAGCAGTGACAGCAGCGACAGCAGCGACAGCAGTGACAGCAGCGACAGCAGCGACAGCAGTGACAGCAGCGACAGCAGCAACAGCAGTGACAGCAG TGACAGCAGTGACAGCAGCGACAGCAGCGACAGCAGTGACAGCAGCGACAGCAGCAACAGCAGTGACAGCAG 5: 104,326,227 (GRCm39) probably benign Het
Fam120a T C 13: 49,055,750 (GRCm39) Y646C probably damaging Het
Hltf T C 3: 20,146,968 (GRCm39) W576R probably damaging Het
Hmcn2 A G 2: 31,279,359 (GRCm39) N1787S probably benign Het
Ift122 A G 6: 115,897,313 (GRCm39) E904G probably benign Het
Igkv17-121 C T 6: 68,013,806 (GRCm39) T2I unknown Het
Ino80 T G 2: 119,269,874 (GRCm39) R590S possibly damaging Het
Intu T A 3: 40,652,069 (GRCm39) I842N probably damaging Het
Itgae A T 11: 73,024,913 (GRCm39) T1015S probably damaging Het
Kank1 GCGAACG GCG 19: 25,388,569 (GRCm39) probably null Het
Kcna10 A G 3: 107,101,663 (GRCm39) E98G probably damaging Het
Kcnb2 T A 1: 15,780,837 (GRCm39) Y570N probably benign Het
Kmt2c T C 5: 25,564,676 (GRCm39) I923V probably benign Het
Kptn A G 7: 15,859,697 (GRCm39) D307G probably damaging Het
Myo3b T C 2: 70,083,458 (GRCm39) Y704H probably damaging Het
Or12d13 A G 17: 37,647,392 (GRCm39) F244L probably benign Het
Or4c100 T A 2: 88,356,014 (GRCm39) L29* probably null Het
Or4c58 A T 2: 89,674,611 (GRCm39) C235* probably null Het
Or4f59 T C 2: 111,872,523 (GRCm39) T285A possibly damaging Het
Pmel G A 10: 128,551,819 (GRCm39) V218M probably damaging Het
Prkar2b T C 12: 32,013,024 (GRCm39) H364R possibly damaging Het
Psd4 T C 2: 24,294,867 (GRCm39) F809S probably damaging Het
Rabgap1l A G 1: 160,078,838 (GRCm39) S59P Het
Rgr A G 14: 36,766,645 (GRCm39) F134L probably benign Het
Scd3 G T 19: 44,222,688 (GRCm39) E113* probably null Het
Slc22a12 G A 19: 6,586,938 (GRCm39) A476V possibly damaging Het
Smg1 T C 7: 117,792,878 (GRCm39) E560G unknown Het
Snx3 A G 10: 42,378,346 (GRCm39) D7G probably benign Het
Son AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG 16: 91,457,222 (GRCm39) probably benign Het
Tbc1d12 A G 19: 38,905,285 (GRCm39) M667V probably benign Het
Tbc1d30 A T 10: 121,142,104 (GRCm39) V81E probably damaging Het
Tbc1d9 A T 8: 83,966,583 (GRCm39) I395F probably damaging Het
Tes C A 6: 17,096,322 (GRCm39) N103K probably benign Het
Tet2 T C 3: 133,193,426 (GRCm39) Y336C possibly damaging Het
Tgfbr3 T C 5: 107,287,726 (GRCm39) N491S probably damaging Het
Tomt T C 7: 101,549,554 (GRCm39) I245V probably damaging Het
Trbc1 T C 6: 41,515,236 (GRCm39) L28P Het
Trp63 T C 16: 25,639,436 (GRCm39) V208A unknown Het
Ttll8 G T 15: 88,799,565 (GRCm39) N625K probably benign Het
Ush2a T A 1: 188,132,135 (GRCm39) W786R probably benign Het
Vmn2r97 A T 17: 19,167,854 (GRCm39) I703F probably damaging Het
Other mutations in Rspry1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Rspry1 APN 8 95,349,608 (GRCm39) intron probably benign
IGL00158:Rspry1 APN 8 95,349,614 (GRCm39) start codon destroyed probably null 0.89
IGL01141:Rspry1 APN 8 95,376,483 (GRCm39) missense probably benign 0.00
IGL01860:Rspry1 APN 8 95,376,444 (GRCm39) missense probably benign 0.00
IGL02174:Rspry1 APN 8 95,359,768 (GRCm39) missense possibly damaging 0.84
IGL02819:Rspry1 APN 8 95,380,884 (GRCm39) missense probably benign 0.42
IGL02926:Rspry1 APN 8 95,376,439 (GRCm39) missense probably damaging 1.00
IGL03366:Rspry1 APN 8 95,376,962 (GRCm39) missense probably benign 0.00
R0570:Rspry1 UTSW 8 95,356,420 (GRCm39) missense probably damaging 1.00
R1833:Rspry1 UTSW 8 95,362,116 (GRCm39) missense probably damaging 1.00
R1988:Rspry1 UTSW 8 95,358,682 (GRCm39) critical splice acceptor site probably null
R2444:Rspry1 UTSW 8 95,349,735 (GRCm39) missense probably damaging 1.00
R3623:Rspry1 UTSW 8 95,376,405 (GRCm39) missense probably damaging 1.00
R3624:Rspry1 UTSW 8 95,376,405 (GRCm39) missense probably damaging 1.00
R4275:Rspry1 UTSW 8 95,376,389 (GRCm39) missense probably benign 0.00
R4888:Rspry1 UTSW 8 95,385,417 (GRCm39) missense probably benign 0.19
R5026:Rspry1 UTSW 8 95,376,931 (GRCm39) missense probably damaging 1.00
R5310:Rspry1 UTSW 8 95,349,813 (GRCm39) missense probably benign
R5374:Rspry1 UTSW 8 95,380,892 (GRCm39) missense probably benign 0.38
R5374:Rspry1 UTSW 8 95,349,636 (GRCm39) missense probably benign 0.00
R5387:Rspry1 UTSW 8 95,364,914 (GRCm39) missense possibly damaging 0.95
R5517:Rspry1 UTSW 8 95,363,388 (GRCm39) splice site probably null
R5631:Rspry1 UTSW 8 95,355,706 (GRCm39) start codon destroyed possibly damaging 0.79
R5653:Rspry1 UTSW 8 95,363,239 (GRCm39) splice site probably null
R6065:Rspry1 UTSW 8 95,349,615 (GRCm39) start codon destroyed probably null 0.98
R6220:Rspry1 UTSW 8 95,385,378 (GRCm39) missense probably damaging 1.00
R6276:Rspry1 UTSW 8 95,349,886 (GRCm39) missense probably damaging 1.00
R6821:Rspry1 UTSW 8 95,362,059 (GRCm39) nonsense probably null
R7390:Rspry1 UTSW 8 95,349,813 (GRCm39) missense probably benign
R7460:Rspry1 UTSW 8 95,376,963 (GRCm39) missense probably benign 0.00
R7644:Rspry1 UTSW 8 95,385,396 (GRCm39) missense probably benign 0.00
R7717:Rspry1 UTSW 8 95,349,750 (GRCm39) missense probably damaging 1.00
R7768:Rspry1 UTSW 8 95,356,469 (GRCm39) missense probably damaging 1.00
R7940:Rspry1 UTSW 8 95,349,635 (GRCm39) missense probably benign 0.22
R8087:Rspry1 UTSW 8 95,380,925 (GRCm39) missense probably benign 0.04
R8174:Rspry1 UTSW 8 95,376,450 (GRCm39) missense probably damaging 0.97
R8326:Rspry1 UTSW 8 95,366,217 (GRCm39) missense probably damaging 1.00
R8676:Rspry1 UTSW 8 95,358,747 (GRCm39) missense probably benign 0.01
R8715:Rspry1 UTSW 8 95,349,888 (GRCm39) missense probably damaging 0.98
R8869:Rspry1 UTSW 8 95,359,780 (GRCm39) missense probably damaging 0.97
R9253:Rspry1 UTSW 8 95,349,621 (GRCm39) missense probably damaging 1.00
R9281:Rspry1 UTSW 8 95,363,259 (GRCm39) missense probably damaging 1.00
R9699:Rspry1 UTSW 8 95,380,857 (GRCm39) missense probably benign 0.01
X0010:Rspry1 UTSW 8 95,356,429 (GRCm39) missense possibly damaging 0.76
Predicted Primers PCR Primer
(F):5'- AGCTGCTTGACCTTCTCCAG -3'
(R):5'- GTATTACCGCCAGTGTGTCCAG -3'

Sequencing Primer
(F):5'- TCCACATTATGAAAACAGTACTCGG -3'
(R):5'- GCACTAACCCATCCACATTTTG -3'
Posted On 2020-09-15