Incidental Mutation 'R7978:Rspry1'
ID651034
Institutional Source Beutler Lab
Gene Symbol Rspry1
Ensembl Gene ENSMUSG00000050079
Gene Namering finger and SPRY domain containing 1
Synonyms4930470D19Rik
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.514) question?
Stock #R7978 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location94601937-94660275 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 94623125 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 47 (R47L)
Ref Sequence ENSEMBL: ENSMUSP00000057275 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060389] [ENSMUST00000121101] [ENSMUST00000211983] [ENSMUST00000212729]
Predicted Effect probably damaging
Transcript: ENSMUST00000060389
AA Change: R47L

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000057275
Gene: ENSMUSG00000050079
AA Change: R47L

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
low complexity region 30 39 N/A INTRINSIC
low complexity region 74 95 N/A INTRINSIC
SPRY 358 482 2.94e-26 SMART
RING 527 561 3.93e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000121101
AA Change: R47L

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000112482
Gene: ENSMUSG00000050079
AA Change: R47L

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
low complexity region 30 39 N/A INTRINSIC
low complexity region 74 95 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000211983
AA Change: R47L

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
Predicted Effect probably benign
Transcript: ENSMUST00000212729
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a glycoprotein that contains a RING-type zinc finger domain and an SPRY domain of unknown function. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Feb 2015]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh A T 5: 76,888,668 I342N probably damaging Het
Alb A T 5: 90,472,073 N453I possibly damaging Het
Aox4 C A 1: 58,235,207 S384Y probably damaging Het
Ap1g1 C T 8: 109,837,767 R315* probably null Het
Cachd1 T C 4: 100,974,863 Y741H probably damaging Het
Cacna2d2 C G 9: 107,518,257 L661V probably benign Het
Ccdc90b T A 7: 92,567,713 H64Q probably damaging Het
Ccdc93 C A 1: 121,499,231 N582K possibly damaging Het
Cdh7 A G 1: 109,994,105 probably benign Het
Cnksr1 T C 4: 134,236,031 N78D probably damaging Het
Cttnbp2nl A G 3: 105,007,991 V132A probably damaging Het
Cwc25 G A 11: 97,753,218 Q230* probably null Het
Dsel G A 1: 111,859,719 R1029* probably null Het
Dspp TGACAGCAGTGACAGCAGCGACAGCAGCGACAGCAGTGACAGCAGCGACAGCAGCGACAGCAGTGACAGCAGCGACAGCAGCAACAGCAGTGACAGCAG TGACAGCAGTGACAGCAGCGACAGCAGCGACAGCAGTGACAGCAGCGACAGCAGCAACAGCAGTGACAGCAG 5: 104,178,361 probably benign Het
Fam120a T C 13: 48,902,274 Y646C probably damaging Het
Hltf T C 3: 20,092,804 W576R probably damaging Het
Hmcn2 A G 2: 31,389,347 N1787S probably benign Het
Ift122 A G 6: 115,920,352 E904G probably benign Het
Igkv17-121 C T 6: 68,036,822 T2I unknown Het
Ino80 T G 2: 119,439,393 R590S possibly damaging Het
Intu T A 3: 40,697,639 I842N probably damaging Het
Itgae A T 11: 73,134,087 T1015S probably damaging Het
Kank1 GCGAACG GCG 19: 25,411,205 probably null Het
Kcna10 A G 3: 107,194,347 E98G probably damaging Het
Kcnb2 T A 1: 15,710,613 Y570N probably benign Het
Kmt2c T C 5: 25,359,678 I923V probably benign Het
Kptn A G 7: 16,125,772 D307G probably damaging Het
Myo3b T C 2: 70,253,114 Y704H probably damaging Het
Olfr103 A G 17: 37,336,501 F244L probably benign Het
Olfr1186 T A 2: 88,525,670 L29* probably null Het
Olfr1312 T C 2: 112,042,178 T285A possibly damaging Het
Olfr48 A T 2: 89,844,267 C235* probably null Het
Pmel G A 10: 128,715,950 V218M probably damaging Het
Prkar2b T C 12: 31,963,025 H364R possibly damaging Het
Psd4 T C 2: 24,404,855 F809S probably damaging Het
Rabgap1l A G 1: 160,251,268 S59P Het
Rgr A G 14: 37,044,688 F134L probably benign Het
Scd3 G T 19: 44,234,249 E113* probably null Het
Slc22a12 G A 19: 6,536,908 A476V possibly damaging Het
Smg1 T C 7: 118,193,655 E560G unknown Het
Snx3 A G 10: 42,502,350 D7G probably benign Het
Son AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG 16: 91,660,334 probably benign Het
Tbc1d12 A G 19: 38,916,841 M667V probably benign Het
Tbc1d30 A T 10: 121,306,199 V81E probably damaging Het
Tbc1d9 A T 8: 83,239,954 I395F probably damaging Het
Tes C A 6: 17,096,323 N103K probably benign Het
Tet2 T C 3: 133,487,665 Y336C possibly damaging Het
Tgfbr3 T C 5: 107,139,860 N491S probably damaging Het
Tomt T C 7: 101,900,347 I245V probably damaging Het
Trbc1 T C 6: 41,538,302 L28P Het
Trp63 T C 16: 25,820,686 V208A unknown Het
Ttll8 G T 15: 88,915,362 N625K probably benign Het
Ush2a T A 1: 188,399,938 W786R probably benign Het
Vmn2r97 A T 17: 18,947,592 I703F probably damaging Het
Other mutations in Rspry1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Rspry1 APN 8 94622986 start codon destroyed probably null 0.89
IGL00158:Rspry1 APN 8 94622980 intron probably benign
IGL01141:Rspry1 APN 8 94649855 missense probably benign 0.00
IGL01860:Rspry1 APN 8 94649816 missense probably benign 0.00
IGL02174:Rspry1 APN 8 94633140 missense possibly damaging 0.84
IGL02819:Rspry1 APN 8 94654256 missense probably benign 0.42
IGL02926:Rspry1 APN 8 94649811 missense probably damaging 1.00
IGL03366:Rspry1 APN 8 94650334 missense probably benign 0.00
R0570:Rspry1 UTSW 8 94629792 missense probably damaging 1.00
R1833:Rspry1 UTSW 8 94635488 missense probably damaging 1.00
R1988:Rspry1 UTSW 8 94632054 critical splice acceptor site probably null
R2444:Rspry1 UTSW 8 94623107 missense probably damaging 1.00
R3623:Rspry1 UTSW 8 94649777 missense probably damaging 1.00
R3624:Rspry1 UTSW 8 94649777 missense probably damaging 1.00
R4275:Rspry1 UTSW 8 94649761 missense probably benign 0.00
R4888:Rspry1 UTSW 8 94658789 missense probably benign 0.19
R5026:Rspry1 UTSW 8 94650303 missense probably damaging 1.00
R5310:Rspry1 UTSW 8 94623185 missense probably benign
R5374:Rspry1 UTSW 8 94623008 missense probably benign 0.00
R5374:Rspry1 UTSW 8 94654264 missense probably benign 0.38
R5387:Rspry1 UTSW 8 94638286 missense possibly damaging 0.95
R5517:Rspry1 UTSW 8 94636760 splice site probably null
R5631:Rspry1 UTSW 8 94629078 start codon destroyed possibly damaging 0.79
R5653:Rspry1 UTSW 8 94636611 splice site probably null
R6065:Rspry1 UTSW 8 94622987 start codon destroyed probably null 0.98
R6220:Rspry1 UTSW 8 94658750 missense probably damaging 1.00
R6276:Rspry1 UTSW 8 94623258 missense probably damaging 1.00
R6821:Rspry1 UTSW 8 94635431 nonsense probably null
R7390:Rspry1 UTSW 8 94623185 missense probably benign
R7460:Rspry1 UTSW 8 94650335 missense probably benign 0.00
R7644:Rspry1 UTSW 8 94658768 missense probably benign 0.00
R7717:Rspry1 UTSW 8 94623122 missense probably damaging 1.00
R7768:Rspry1 UTSW 8 94629841 missense probably damaging 1.00
R7940:Rspry1 UTSW 8 94623007 missense probably benign 0.22
R8087:Rspry1 UTSW 8 94654297 missense probably benign 0.04
R8174:Rspry1 UTSW 8 94649822 missense probably damaging 0.97
R8326:Rspry1 UTSW 8 94639589 missense probably damaging 1.00
R8676:Rspry1 UTSW 8 94632119 missense probably benign 0.01
R8715:Rspry1 UTSW 8 94623260 missense probably damaging 0.98
R8869:Rspry1 UTSW 8 94633152 missense probably damaging 0.97
X0010:Rspry1 UTSW 8 94629801 missense possibly damaging 0.76
Predicted Primers PCR Primer
(F):5'- AGCTGCTTGACCTTCTCCAG -3'
(R):5'- GTATTACCGCCAGTGTGTCCAG -3'

Sequencing Primer
(F):5'- TCCACATTATGAAAACAGTACTCGG -3'
(R):5'- GCACTAACCCATCCACATTTTG -3'
Posted On2020-09-15