Incidental Mutation 'R7978:Cacna2d2'
ID651036
Institutional Source Beutler Lab
Gene Symbol Cacna2d2
Ensembl Gene ENSMUSG00000010066
Gene Namecalcium channel, voltage-dependent, alpha 2/delta subunit 2
Synonymsa2d2
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.875) question?
Stock #R7978 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location107399612-107529343 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 107518257 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Valine at position 661 (L661V)
Ref Sequence ENSEMBL: ENSMUSP00000010210 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000010210] [ENSMUST00000085092] [ENSMUST00000164988] [ENSMUST00000166799] [ENSMUST00000168532] [ENSMUST00000170737]
Predicted Effect probably benign
Transcript: ENSMUST00000010210
AA Change: L661V

PolyPhen 2 Score 0.143 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000010210
Gene: ENSMUSG00000010066
AA Change: L661V

DomainStartEndE-ValueType
low complexity region 20 36 N/A INTRINSIC
low complexity region 43 57 N/A INTRINSIC
Pfam:VWA_N 144 268 2e-48 PFAM
VWA 292 467 4.93e-22 SMART
Pfam:Cache_1 488 577 9.9e-32 PFAM
Pfam:VGCC_alpha2 583 673 1.8e-33 PFAM
low complexity region 968 977 N/A INTRINSIC
low complexity region 1114 1137 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000085092
AA Change: L661V

PolyPhen 2 Score 0.951 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000082173
Gene: ENSMUSG00000010066
AA Change: L661V

DomainStartEndE-ValueType
low complexity region 20 36 N/A INTRINSIC
low complexity region 43 57 N/A INTRINSIC
Pfam:VWA_N 144 268 2e-48 PFAM
VWA 292 467 4.93e-22 SMART
Pfam:Cache_1 488 577 1e-31 PFAM
Pfam:VGCC_alpha2 583 676 5.8e-35 PFAM
low complexity region 974 983 N/A INTRINSIC
low complexity region 1120 1143 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164988
AA Change: L661V

PolyPhen 2 Score 0.088 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000130451
Gene: ENSMUSG00000010066
AA Change: L661V

DomainStartEndE-ValueType
low complexity region 20 36 N/A INTRINSIC
low complexity region 43 57 N/A INTRINSIC
Pfam:VWA_N 144 268 6.7e-49 PFAM
VWA 292 467 4.93e-22 SMART
Pfam:Cache_1 488 577 2.4e-31 PFAM
Pfam:VGCC_alpha2 583 675 2.5e-34 PFAM
low complexity region 974 983 N/A INTRINSIC
low complexity region 1123 1146 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000166799
AA Change: L661V

PolyPhen 2 Score 0.034 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000126029
Gene: ENSMUSG00000010066
AA Change: L661V

DomainStartEndE-ValueType
low complexity region 20 36 N/A INTRINSIC
low complexity region 43 57 N/A INTRINSIC
Pfam:VWA_N 144 268 8.5e-44 PFAM
VWA 292 467 4.93e-22 SMART
Pfam:Cache_1 488 576 1.3e-32 PFAM
Pfam:VGCC_alpha2 583 675 1.4e-47 PFAM
low complexity region 975 984 N/A INTRINSIC
low complexity region 1123 1146 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000168532
AA Change: L661V

PolyPhen 2 Score 0.336 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000132512
Gene: ENSMUSG00000010066
AA Change: L661V

DomainStartEndE-ValueType
low complexity region 20 36 N/A INTRINSIC
low complexity region 43 57 N/A INTRINSIC
Pfam:VWA_N 144 268 2.1e-48 PFAM
VWA 292 467 4.93e-22 SMART
Pfam:Cache_1 488 577 1e-31 PFAM
Pfam:VGCC_alpha2 583 676 5.8e-35 PFAM
low complexity region 974 983 N/A INTRINSIC
low complexity region 1122 1145 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000170737
AA Change: L661V

PolyPhen 2 Score 0.289 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000125943
Gene: ENSMUSG00000010066
AA Change: L661V

DomainStartEndE-ValueType
low complexity region 20 36 N/A INTRINSIC
low complexity region 43 57 N/A INTRINSIC
Pfam:VWA_N 144 268 2e-48 PFAM
VWA 292 467 4.93e-22 SMART
Pfam:Cache_1 488 577 1e-31 PFAM
Pfam:VGCC_alpha2 583 673 1.9e-33 PFAM
low complexity region 968 977 N/A INTRINSIC
low complexity region 1116 1139 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Calcium channels mediate the entry of calcium ions into the cell upon membrane polarization. This gene encodes the alpha-2/delta subunit of the voltage-dependent calcium channel complex. The complex consists of the main channel-forming subunit alpha-1, and auxiliary subunits alpha-2/delta, beta, and gamma. The auxiliary subunits function in the assembly and membrane localization of the complex, and modulate calcium currents and channel activation/inactivation kinetics. The subunit encoded by this gene undergoes post-translational cleavage to yield the extracellular alpha2 peptide and a membrane-anchored delta polypeptide. This subunit is a receptor for the antiepileptic drug, gabapentin. Mutations in this gene are associated with early infantile epileptic encephalopathy. Single nucleotide polymorphisms in this gene are correlated with increased sensitivity to opioid drugs. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Mar 2014]
PHENOTYPE: Homozygotes for different mutant alleles show variable movement abnormalities including waddling, reeling or very slow gait, ataxia, and mild spike-wave seizures. While gross CNS abnormalities and demyelination are present in some mutant lines, they are not observed in others. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh A T 5: 76,888,668 I342N probably damaging Het
Alb A T 5: 90,472,073 N453I possibly damaging Het
Aox4 C A 1: 58,235,207 S384Y probably damaging Het
Ap1g1 C T 8: 109,837,767 R315* probably null Het
Cachd1 T C 4: 100,974,863 Y741H probably damaging Het
Ccdc90b T A 7: 92,567,713 H64Q probably damaging Het
Ccdc93 C A 1: 121,499,231 N582K possibly damaging Het
Cdh7 A G 1: 109,994,105 probably benign Het
Cnksr1 T C 4: 134,236,031 N78D probably damaging Het
Cttnbp2nl A G 3: 105,007,991 V132A probably damaging Het
Cwc25 G A 11: 97,753,218 Q230* probably null Het
Dsel G A 1: 111,859,719 R1029* probably null Het
Dspp TGACAGCAGTGACAGCAGCGACAGCAGCGACAGCAGTGACAGCAGCGACAGCAGCGACAGCAGTGACAGCAGCGACAGCAGCAACAGCAGTGACAGCAG TGACAGCAGTGACAGCAGCGACAGCAGCGACAGCAGTGACAGCAGCGACAGCAGCAACAGCAGTGACAGCAG 5: 104,178,361 probably benign Het
Fam120a T C 13: 48,902,274 Y646C probably damaging Het
Hltf T C 3: 20,092,804 W576R probably damaging Het
Hmcn2 A G 2: 31,389,347 N1787S probably benign Het
Ift122 A G 6: 115,920,352 E904G probably benign Het
Igkv17-121 C T 6: 68,036,822 T2I unknown Het
Ino80 T G 2: 119,439,393 R590S possibly damaging Het
Intu T A 3: 40,697,639 I842N probably damaging Het
Itgae A T 11: 73,134,087 T1015S probably damaging Het
Kank1 GCGAACG GCG 19: 25,411,205 probably null Het
Kcna10 A G 3: 107,194,347 E98G probably damaging Het
Kcnb2 T A 1: 15,710,613 Y570N probably benign Het
Kmt2c T C 5: 25,359,678 I923V probably benign Het
Kptn A G 7: 16,125,772 D307G probably damaging Het
Myo3b T C 2: 70,253,114 Y704H probably damaging Het
Olfr103 A G 17: 37,336,501 F244L probably benign Het
Olfr1186 T A 2: 88,525,670 L29* probably null Het
Olfr1312 T C 2: 112,042,178 T285A possibly damaging Het
Olfr48 A T 2: 89,844,267 C235* probably null Het
Pmel G A 10: 128,715,950 V218M probably damaging Het
Prkar2b T C 12: 31,963,025 H364R possibly damaging Het
Psd4 T C 2: 24,404,855 F809S probably damaging Het
Rabgap1l A G 1: 160,251,268 S59P Het
Rgr A G 14: 37,044,688 F134L probably benign Het
Rspry1 G T 8: 94,623,125 R47L probably damaging Het
Scd3 G T 19: 44,234,249 E113* probably null Het
Slc22a12 G A 19: 6,536,908 A476V possibly damaging Het
Smg1 T C 7: 118,193,655 E560G unknown Het
Snx3 A G 10: 42,502,350 D7G probably benign Het
Son AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG 16: 91,660,334 probably benign Het
Tbc1d12 A G 19: 38,916,841 M667V probably benign Het
Tbc1d30 A T 10: 121,306,199 V81E probably damaging Het
Tbc1d9 A T 8: 83,239,954 I395F probably damaging Het
Tes C A 6: 17,096,323 N103K probably benign Het
Tet2 T C 3: 133,487,665 Y336C possibly damaging Het
Tgfbr3 T C 5: 107,139,860 N491S probably damaging Het
Tomt T C 7: 101,900,347 I245V probably damaging Het
Trbc1 T C 6: 41,538,302 L28P Het
Trp63 T C 16: 25,820,686 V208A unknown Het
Ttll8 G T 15: 88,915,362 N625K probably benign Het
Ush2a T A 1: 188,399,938 W786R probably benign Het
Vmn2r97 A T 17: 18,947,592 I703F probably damaging Het
Other mutations in Cacna2d2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00401:Cacna2d2 APN 9 107514873 missense probably damaging 1.00
IGL00425:Cacna2d2 APN 9 107527351 missense probably damaging 1.00
IGL01294:Cacna2d2 APN 9 107514081 missense probably damaging 1.00
IGL01969:Cacna2d2 APN 9 107509216 missense probably benign
IGL01974:Cacna2d2 APN 9 107517422 missense probably benign 0.00
IGL02001:Cacna2d2 APN 9 107522116 missense probably benign
IGL02125:Cacna2d2 APN 9 107513904 nonsense probably null
IGL02143:Cacna2d2 APN 9 107518275 splice site probably null
IGL02150:Cacna2d2 APN 9 107527316 splice site probably benign
IGL02213:Cacna2d2 APN 9 107514048 missense probably damaging 1.00
IGL02220:Cacna2d2 APN 9 107514879 missense probably damaging 1.00
IGL02238:Cacna2d2 APN 9 107513558 missense probably damaging 0.99
IGL02466:Cacna2d2 APN 9 107465554 missense probably damaging 1.00
IGL02569:Cacna2d2 APN 9 107514046 missense probably damaging 0.99
IGL02571:Cacna2d2 APN 9 107525646 missense possibly damaging 0.93
IGL02825:Cacna2d2 APN 9 107524460 missense probably damaging 1.00
IGL03000:Cacna2d2 APN 9 107524198 splice site probably null
IGL03064:Cacna2d2 APN 9 107509275 missense probably damaging 1.00
Blow UTSW 9 107513606 missense probably null 0.90
hera UTSW 9 107513280 missense probably damaging 1.00
PIT4131001:Cacna2d2 UTSW 9 107524668 missense probably damaging 1.00
R0233:Cacna2d2 UTSW 9 107514670 missense probably damaging 0.96
R0233:Cacna2d2 UTSW 9 107514670 missense probably damaging 0.96
R0387:Cacna2d2 UTSW 9 107513881 missense probably damaging 1.00
R0410:Cacna2d2 UTSW 9 107524620 missense probably damaging 1.00
R0538:Cacna2d2 UTSW 9 107524383 splice site probably benign
R0545:Cacna2d2 UTSW 9 107525223 missense probably damaging 1.00
R0729:Cacna2d2 UTSW 9 107517257 missense probably benign 0.06
R1024:Cacna2d2 UTSW 9 107527050 critical splice donor site probably null
R1538:Cacna2d2 UTSW 9 107517416 missense probably damaging 1.00
R1750:Cacna2d2 UTSW 9 107524644 missense probably damaging 1.00
R1774:Cacna2d2 UTSW 9 107526151 missense probably benign 0.19
R1800:Cacna2d2 UTSW 9 107527433 missense possibly damaging 0.46
R1873:Cacna2d2 UTSW 9 107513872 missense probably damaging 0.98
R1935:Cacna2d2 UTSW 9 107509256 missense probably damaging 1.00
R1936:Cacna2d2 UTSW 9 107509256 missense probably damaging 1.00
R1971:Cacna2d2 UTSW 9 107512006 missense probably damaging 0.98
R2095:Cacna2d2 UTSW 9 107527165 missense probably benign 0.05
R2135:Cacna2d2 UTSW 9 107526513 missense possibly damaging 0.74
R2197:Cacna2d2 UTSW 9 107527403 missense probably damaging 0.97
R2266:Cacna2d2 UTSW 9 107513280 missense probably damaging 1.00
R2483:Cacna2d2 UTSW 9 107512022 missense probably damaging 1.00
R4021:Cacna2d2 UTSW 9 107514058 missense probably damaging 1.00
R4392:Cacna2d2 UTSW 9 107400280 missense possibly damaging 0.47
R4629:Cacna2d2 UTSW 9 107527322 missense probably damaging 1.00
R5053:Cacna2d2 UTSW 9 107514864 missense probably damaging 1.00
R5327:Cacna2d2 UTSW 9 107513606 missense probably null 0.90
R5347:Cacna2d2 UTSW 9 107514114 missense probably benign
R5719:Cacna2d2 UTSW 9 107524652 missense probably benign 0.36
R5737:Cacna2d2 UTSW 9 107526747 missense possibly damaging 0.70
R5739:Cacna2d2 UTSW 9 107512329 missense probably benign 0.37
R6037:Cacna2d2 UTSW 9 107513539 missense probably damaging 1.00
R6037:Cacna2d2 UTSW 9 107513539 missense probably damaging 1.00
R6084:Cacna2d2 UTSW 9 107497521 critical splice donor site probably null
R6170:Cacna2d2 UTSW 9 107527334 missense probably damaging 1.00
R6254:Cacna2d2 UTSW 9 107509216 missense probably benign
R6427:Cacna2d2 UTSW 9 107515442 missense possibly damaging 0.67
R7652:Cacna2d2 UTSW 9 107524198 splice site probably null
R7850:Cacna2d2 UTSW 9 107525376 missense probably benign 0.05
R7936:Cacna2d2 UTSW 9 107524127 missense probably damaging 1.00
R8039:Cacna2d2 UTSW 9 107527433 missense possibly damaging 0.92
R8165:Cacna2d2 UTSW 9 107525454 splice site probably null
R8274:Cacna2d2 UTSW 9 107524662 missense possibly damaging 0.94
R8286:Cacna2d2 UTSW 9 107514864 missense probably damaging 1.00
Z1176:Cacna2d2 UTSW 9 107517293 missense probably damaging 1.00
Z1176:Cacna2d2 UTSW 9 107526102 missense probably benign 0.14
Predicted Primers PCR Primer
(F):5'- CACAGCTTGAGCCTCTTTGG -3'
(R):5'- AGAATGGTCTAGAGCCAAATCC -3'

Sequencing Primer
(F):5'- GCTCCAAGGCCCTAGGAAAG -3'
(R):5'- GCAGATTTCCACAGACTTTTGAAGG -3'
Posted On2020-09-15