Incidental Mutation 'R7978:Tbc1d30'
ID 651038
Institutional Source Beutler Lab
Gene Symbol Tbc1d30
Ensembl Gene ENSMUSG00000052302
Gene Name TBC1 domain family, member 30
Synonyms 4930505D03Rik
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7978 (G1)
Quality Score 225.009
Status Not validated
Chromosome 10
Chromosomal Location 121099725-121187183 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 121142104 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Glutamic Acid at position 81 (V81E)
Ref Sequence ENSEMBL: ENSMUSP00000070488 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064107] [ENSMUST00000219179]
AlphaFold Q69ZT9
Predicted Effect probably damaging
Transcript: ENSMUST00000064107
AA Change: V81E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000070488
Gene: ENSMUSG00000052302
AA Change: V81E

DomainStartEndE-ValueType
low complexity region 11 26 N/A INTRINSIC
TBC 84 318 2.22e-30 SMART
low complexity region 392 403 N/A INTRINSIC
Pfam:DUF4682 475 613 4.3e-50 PFAM
low complexity region 623 633 N/A INTRINSIC
low complexity region 649 657 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000219179
AA Change: V171E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh A T 5: 77,036,515 (GRCm39) I342N probably damaging Het
Alb A T 5: 90,619,932 (GRCm39) N453I possibly damaging Het
Aox4 C A 1: 58,274,366 (GRCm39) S384Y probably damaging Het
Ap1g1 C T 8: 110,564,399 (GRCm39) R315* probably null Het
Cachd1 T C 4: 100,832,060 (GRCm39) Y741H probably damaging Het
Cacna2d2 C G 9: 107,395,456 (GRCm39) L661V probably benign Het
Ccdc90b T A 7: 92,216,921 (GRCm39) H64Q probably damaging Het
Ccdc93 C A 1: 121,426,960 (GRCm39) N582K possibly damaging Het
Cdh20 A G 1: 109,921,835 (GRCm39) probably benign Het
Cnksr1 T C 4: 133,963,342 (GRCm39) N78D probably damaging Het
Cttnbp2nl A G 3: 104,915,307 (GRCm39) V132A probably damaging Het
Cwc25 G A 11: 97,644,044 (GRCm39) Q230* probably null Het
Dsel G A 1: 111,787,449 (GRCm39) R1029* probably null Het
Dspp TGACAGCAGTGACAGCAGCGACAGCAGCGACAGCAGTGACAGCAGCGACAGCAGCGACAGCAGTGACAGCAGCGACAGCAGCAACAGCAGTGACAGCAG TGACAGCAGTGACAGCAGCGACAGCAGCGACAGCAGTGACAGCAGCGACAGCAGCAACAGCAGTGACAGCAG 5: 104,326,227 (GRCm39) probably benign Het
Fam120a T C 13: 49,055,750 (GRCm39) Y646C probably damaging Het
Hltf T C 3: 20,146,968 (GRCm39) W576R probably damaging Het
Hmcn2 A G 2: 31,279,359 (GRCm39) N1787S probably benign Het
Ift122 A G 6: 115,897,313 (GRCm39) E904G probably benign Het
Igkv17-121 C T 6: 68,013,806 (GRCm39) T2I unknown Het
Ino80 T G 2: 119,269,874 (GRCm39) R590S possibly damaging Het
Intu T A 3: 40,652,069 (GRCm39) I842N probably damaging Het
Itgae A T 11: 73,024,913 (GRCm39) T1015S probably damaging Het
Kank1 GCGAACG GCG 19: 25,388,569 (GRCm39) probably null Het
Kcna10 A G 3: 107,101,663 (GRCm39) E98G probably damaging Het
Kcnb2 T A 1: 15,780,837 (GRCm39) Y570N probably benign Het
Kmt2c T C 5: 25,564,676 (GRCm39) I923V probably benign Het
Kptn A G 7: 15,859,697 (GRCm39) D307G probably damaging Het
Myo3b T C 2: 70,083,458 (GRCm39) Y704H probably damaging Het
Or12d13 A G 17: 37,647,392 (GRCm39) F244L probably benign Het
Or4c100 T A 2: 88,356,014 (GRCm39) L29* probably null Het
Or4c58 A T 2: 89,674,611 (GRCm39) C235* probably null Het
Or4f59 T C 2: 111,872,523 (GRCm39) T285A possibly damaging Het
Pmel G A 10: 128,551,819 (GRCm39) V218M probably damaging Het
Prkar2b T C 12: 32,013,024 (GRCm39) H364R possibly damaging Het
Psd4 T C 2: 24,294,867 (GRCm39) F809S probably damaging Het
Rabgap1l A G 1: 160,078,838 (GRCm39) S59P Het
Rgr A G 14: 36,766,645 (GRCm39) F134L probably benign Het
Rspry1 G T 8: 95,349,753 (GRCm39) R47L probably damaging Het
Scd3 G T 19: 44,222,688 (GRCm39) E113* probably null Het
Slc22a12 G A 19: 6,586,938 (GRCm39) A476V possibly damaging Het
Smg1 T C 7: 117,792,878 (GRCm39) E560G unknown Het
Snx3 A G 10: 42,378,346 (GRCm39) D7G probably benign Het
Son AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG 16: 91,457,222 (GRCm39) probably benign Het
Tbc1d12 A G 19: 38,905,285 (GRCm39) M667V probably benign Het
Tbc1d9 A T 8: 83,966,583 (GRCm39) I395F probably damaging Het
Tes C A 6: 17,096,322 (GRCm39) N103K probably benign Het
Tet2 T C 3: 133,193,426 (GRCm39) Y336C possibly damaging Het
Tgfbr3 T C 5: 107,287,726 (GRCm39) N491S probably damaging Het
Tomt T C 7: 101,549,554 (GRCm39) I245V probably damaging Het
Trbc1 T C 6: 41,515,236 (GRCm39) L28P Het
Trp63 T C 16: 25,639,436 (GRCm39) V208A unknown Het
Ttll8 G T 15: 88,799,565 (GRCm39) N625K probably benign Het
Ush2a T A 1: 188,132,135 (GRCm39) W786R probably benign Het
Vmn2r97 A T 17: 19,167,854 (GRCm39) I703F probably damaging Het
Other mutations in Tbc1d30
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00818:Tbc1d30 APN 10 121,102,729 (GRCm39) utr 3 prime probably benign
IGL00837:Tbc1d30 APN 10 121,132,750 (GRCm39) missense probably damaging 1.00
IGL01081:Tbc1d30 APN 10 121,103,319 (GRCm39) missense probably damaging 1.00
IGL01813:Tbc1d30 APN 10 121,102,956 (GRCm39) missense probably benign
IGL01844:Tbc1d30 APN 10 121,103,084 (GRCm39) missense probably benign 0.01
R1782:Tbc1d30 UTSW 10 121,103,525 (GRCm39) missense probably damaging 1.00
R1972:Tbc1d30 UTSW 10 121,142,135 (GRCm39) splice site probably null
R2025:Tbc1d30 UTSW 10 121,115,051 (GRCm39) missense probably benign 0.18
R2197:Tbc1d30 UTSW 10 121,140,312 (GRCm39) missense probably damaging 1.00
R3752:Tbc1d30 UTSW 10 121,108,073 (GRCm39) missense probably damaging 1.00
R4374:Tbc1d30 UTSW 10 121,130,617 (GRCm39) missense probably damaging 1.00
R4540:Tbc1d30 UTSW 10 121,115,063 (GRCm39) missense probably damaging 0.99
R4624:Tbc1d30 UTSW 10 121,132,691 (GRCm39) missense probably damaging 0.99
R4960:Tbc1d30 UTSW 10 121,103,121 (GRCm39) missense probably benign 0.04
R5170:Tbc1d30 UTSW 10 121,142,743 (GRCm39) missense possibly damaging 0.49
R5566:Tbc1d30 UTSW 10 121,138,015 (GRCm39) missense probably damaging 1.00
R5642:Tbc1d30 UTSW 10 121,132,692 (GRCm39) missense probably damaging 1.00
R5726:Tbc1d30 UTSW 10 121,103,479 (GRCm39) missense probably damaging 1.00
R6051:Tbc1d30 UTSW 10 121,132,750 (GRCm39) missense probably damaging 1.00
R6364:Tbc1d30 UTSW 10 121,130,630 (GRCm39) missense possibly damaging 0.95
R7106:Tbc1d30 UTSW 10 121,137,897 (GRCm39) missense possibly damaging 0.94
R7233:Tbc1d30 UTSW 10 121,107,962 (GRCm39) missense probably benign 0.35
R7256:Tbc1d30 UTSW 10 121,124,870 (GRCm39) missense probably damaging 1.00
R7826:Tbc1d30 UTSW 10 121,132,710 (GRCm39) missense probably damaging 1.00
R7910:Tbc1d30 UTSW 10 121,183,061 (GRCm39) nonsense probably null
R7958:Tbc1d30 UTSW 10 121,107,962 (GRCm39) missense probably benign 0.35
R8021:Tbc1d30 UTSW 10 121,103,448 (GRCm39) missense probably benign 0.09
R8394:Tbc1d30 UTSW 10 121,183,013 (GRCm39) nonsense probably null
R8472:Tbc1d30 UTSW 10 121,187,009 (GRCm39) missense probably benign 0.00
R8532:Tbc1d30 UTSW 10 121,103,335 (GRCm39) missense probably damaging 1.00
R8887:Tbc1d30 UTSW 10 121,187,059 (GRCm39) missense possibly damaging 0.45
R9124:Tbc1d30 UTSW 10 121,132,716 (GRCm39) missense probably damaging 0.99
R9186:Tbc1d30 UTSW 10 121,111,639 (GRCm39) missense probably benign
R9282:Tbc1d30 UTSW 10 121,142,128 (GRCm39) critical splice acceptor site probably null
R9342:Tbc1d30 UTSW 10 121,103,366 (GRCm39) nonsense probably null
R9531:Tbc1d30 UTSW 10 121,183,105 (GRCm39) missense probably damaging 1.00
R9665:Tbc1d30 UTSW 10 121,102,886 (GRCm39) missense possibly damaging 0.83
R9799:Tbc1d30 UTSW 10 121,142,074 (GRCm39) missense possibly damaging 0.55
R9803:Tbc1d30 UTSW 10 121,107,980 (GRCm39) missense probably damaging 1.00
Z1176:Tbc1d30 UTSW 10 121,138,018 (GRCm39) missense probably damaging 1.00
Z1177:Tbc1d30 UTSW 10 121,186,969 (GRCm39) missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- AACGTTACCTGGCACGAATG -3'
(R):5'- AACTTTCTCACGTTCTATGGATGC -3'

Sequencing Primer
(F):5'- GTTACCTGGCACGAATGATAAATACC -3'
(R):5'- AGCACTGTTCATCGCTGAAG -3'
Posted On 2020-09-15