Incidental Mutation 'R7978:Kank1'
ID 651051
Institutional Source Beutler Lab
Gene Symbol Kank1
Ensembl Gene ENSMUSG00000032702
Gene Name KN motif and ankyrin repeat domains 1
Synonyms Ankrd15, D330024H06Rik, A930031B09Rik
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7978 (G1)
Quality Score 217.468
Status Not validated
Chromosome 19
Chromosomal Location 25214339-25411860 bp(+) (GRCm39)
Type of Mutation frame shift
DNA Base Change (assembly) GCGAACG to GCG at 25388569 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000116660 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049400] [ENSMUST00000146647]
AlphaFold E9Q238
Predicted Effect probably null
Transcript: ENSMUST00000049400
SMART Domains Protein: ENSMUSP00000042177
Gene: ENSMUSG00000032702

DomainStartEndE-ValueType
Pfam:KN_motif 30 68 3.3e-24 PFAM
low complexity region 88 105 N/A INTRINSIC
low complexity region 138 148 N/A INTRINSIC
coiled coil region 286 314 N/A INTRINSIC
low complexity region 350 358 N/A INTRINSIC
coiled coil region 362 395 N/A INTRINSIC
coiled coil region 451 494 N/A INTRINSIC
low complexity region 541 556 N/A INTRINSIC
low complexity region 617 629 N/A INTRINSIC
Blast:ANK 963 993 7e-10 BLAST
low complexity region 1010 1030 N/A INTRINSIC
low complexity region 1074 1095 N/A INTRINSIC
ANK 1169 1199 3.71e-4 SMART
ANK 1203 1236 2.27e1 SMART
ANK 1241 1270 1.33e-5 SMART
ANK 1274 1306 5.84e-2 SMART
ANK 1308 1336 4.86e1 SMART
Predicted Effect probably null
Transcript: ENSMUST00000146647
SMART Domains Protein: ENSMUSP00000116660
Gene: ENSMUSG00000032702

DomainStartEndE-ValueType
Pfam:KN_motif 58 96 2e-25 PFAM
low complexity region 116 133 N/A INTRINSIC
low complexity region 166 176 N/A INTRINSIC
coiled coil region 314 342 N/A INTRINSIC
low complexity region 378 386 N/A INTRINSIC
coiled coil region 390 423 N/A INTRINSIC
internal_repeat_1 430 479 3.72e-5 PROSPERO
low complexity region 569 584 N/A INTRINSIC
internal_repeat_1 587 636 3.72e-5 PROSPERO
low complexity region 645 657 N/A INTRINSIC
Blast:ANK 991 1021 4e-10 BLAST
low complexity region 1038 1058 N/A INTRINSIC
low complexity region 1102 1123 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the Kank family of proteins, which contain multiple ankyrin repeat domains. This family member functions in cytoskeleton formation by regulating actin polymerization. This gene is a candidate tumor suppressor for renal cell carcinoma. Mutations in this gene cause cerebral palsy spastic quadriplegic type 2, a central nervous system development disorder. A t(5;9) translocation results in fusion of the platelet-derived growth factor receptor beta gene (PDGFRB) on chromosome 5 with this gene in a myeloproliferative neoplasm featuring severe thrombocythemia. Alternative splicing of this gene results in multiple transcript variants. A related pseudogene has been identified on chromosome 20. [provided by RefSeq, Dec 2014]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh A T 5: 77,036,515 (GRCm39) I342N probably damaging Het
Alb A T 5: 90,619,932 (GRCm39) N453I possibly damaging Het
Aox4 C A 1: 58,274,366 (GRCm39) S384Y probably damaging Het
Ap1g1 C T 8: 110,564,399 (GRCm39) R315* probably null Het
Cachd1 T C 4: 100,832,060 (GRCm39) Y741H probably damaging Het
Cacna2d2 C G 9: 107,395,456 (GRCm39) L661V probably benign Het
Ccdc90b T A 7: 92,216,921 (GRCm39) H64Q probably damaging Het
Ccdc93 C A 1: 121,426,960 (GRCm39) N582K possibly damaging Het
Cdh20 A G 1: 109,921,835 (GRCm39) probably benign Het
Cnksr1 T C 4: 133,963,342 (GRCm39) N78D probably damaging Het
Cttnbp2nl A G 3: 104,915,307 (GRCm39) V132A probably damaging Het
Cwc25 G A 11: 97,644,044 (GRCm39) Q230* probably null Het
Dsel G A 1: 111,787,449 (GRCm39) R1029* probably null Het
Dspp TGACAGCAGTGACAGCAGCGACAGCAGCGACAGCAGTGACAGCAGCGACAGCAGCGACAGCAGTGACAGCAGCGACAGCAGCAACAGCAGTGACAGCAG TGACAGCAGTGACAGCAGCGACAGCAGCGACAGCAGTGACAGCAGCGACAGCAGCAACAGCAGTGACAGCAG 5: 104,326,227 (GRCm39) probably benign Het
Fam120a T C 13: 49,055,750 (GRCm39) Y646C probably damaging Het
Hltf T C 3: 20,146,968 (GRCm39) W576R probably damaging Het
Hmcn2 A G 2: 31,279,359 (GRCm39) N1787S probably benign Het
Ift122 A G 6: 115,897,313 (GRCm39) E904G probably benign Het
Igkv17-121 C T 6: 68,013,806 (GRCm39) T2I unknown Het
Ino80 T G 2: 119,269,874 (GRCm39) R590S possibly damaging Het
Intu T A 3: 40,652,069 (GRCm39) I842N probably damaging Het
Itgae A T 11: 73,024,913 (GRCm39) T1015S probably damaging Het
Kcna10 A G 3: 107,101,663 (GRCm39) E98G probably damaging Het
Kcnb2 T A 1: 15,780,837 (GRCm39) Y570N probably benign Het
Kmt2c T C 5: 25,564,676 (GRCm39) I923V probably benign Het
Kptn A G 7: 15,859,697 (GRCm39) D307G probably damaging Het
Myo3b T C 2: 70,083,458 (GRCm39) Y704H probably damaging Het
Or12d13 A G 17: 37,647,392 (GRCm39) F244L probably benign Het
Or4c100 T A 2: 88,356,014 (GRCm39) L29* probably null Het
Or4c58 A T 2: 89,674,611 (GRCm39) C235* probably null Het
Or4f59 T C 2: 111,872,523 (GRCm39) T285A possibly damaging Het
Pmel G A 10: 128,551,819 (GRCm39) V218M probably damaging Het
Prkar2b T C 12: 32,013,024 (GRCm39) H364R possibly damaging Het
Psd4 T C 2: 24,294,867 (GRCm39) F809S probably damaging Het
Rabgap1l A G 1: 160,078,838 (GRCm39) S59P Het
Rgr A G 14: 36,766,645 (GRCm39) F134L probably benign Het
Rspry1 G T 8: 95,349,753 (GRCm39) R47L probably damaging Het
Scd3 G T 19: 44,222,688 (GRCm39) E113* probably null Het
Slc22a12 G A 19: 6,586,938 (GRCm39) A476V possibly damaging Het
Smg1 T C 7: 117,792,878 (GRCm39) E560G unknown Het
Snx3 A G 10: 42,378,346 (GRCm39) D7G probably benign Het
Son AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG 16: 91,457,222 (GRCm39) probably benign Het
Tbc1d12 A G 19: 38,905,285 (GRCm39) M667V probably benign Het
Tbc1d30 A T 10: 121,142,104 (GRCm39) V81E probably damaging Het
Tbc1d9 A T 8: 83,966,583 (GRCm39) I395F probably damaging Het
Tes C A 6: 17,096,322 (GRCm39) N103K probably benign Het
Tet2 T C 3: 133,193,426 (GRCm39) Y336C possibly damaging Het
Tgfbr3 T C 5: 107,287,726 (GRCm39) N491S probably damaging Het
Tomt T C 7: 101,549,554 (GRCm39) I245V probably damaging Het
Trbc1 T C 6: 41,515,236 (GRCm39) L28P Het
Trp63 T C 16: 25,639,436 (GRCm39) V208A unknown Het
Ttll8 G T 15: 88,799,565 (GRCm39) N625K probably benign Het
Ush2a T A 1: 188,132,135 (GRCm39) W786R probably benign Het
Vmn2r97 A T 17: 19,167,854 (GRCm39) I703F probably damaging Het
Other mutations in Kank1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00324:Kank1 APN 19 25,389,122 (GRCm39) missense probably benign
IGL00435:Kank1 APN 19 25,407,600 (GRCm39) missense probably benign 0.41
IGL01105:Kank1 APN 19 25,401,680 (GRCm39) missense possibly damaging 0.80
IGL01974:Kank1 APN 19 25,387,596 (GRCm39) missense possibly damaging 0.87
IGL02031:Kank1 APN 19 25,388,066 (GRCm39) missense probably benign 0.01
IGL02125:Kank1 APN 19 25,388,067 (GRCm39) missense possibly damaging 0.90
IGL02152:Kank1 APN 19 25,405,536 (GRCm39) missense possibly damaging 0.51
IGL02211:Kank1 APN 19 25,407,702 (GRCm39) missense probably damaging 1.00
IGL02440:Kank1 APN 19 25,410,272 (GRCm39) missense probably damaging 1.00
IGL02448:Kank1 APN 19 25,388,739 (GRCm39) missense probably damaging 1.00
IGL02671:Kank1 APN 19 25,405,459 (GRCm39) missense probably damaging 1.00
IGL03102:Kank1 APN 19 25,403,282 (GRCm39) missense probably damaging 1.00
IGL03259:Kank1 APN 19 25,407,705 (GRCm39) missense probably damaging 1.00
IGL02802:Kank1 UTSW 19 25,388,963 (GRCm39) missense probably damaging 1.00
R0107:Kank1 UTSW 19 25,407,730 (GRCm39) unclassified probably benign
R0190:Kank1 UTSW 19 25,386,647 (GRCm39) missense probably benign 0.00
R0330:Kank1 UTSW 19 25,401,677 (GRCm39) missense probably benign 0.00
R0368:Kank1 UTSW 19 25,387,967 (GRCm39) nonsense probably null
R0399:Kank1 UTSW 19 25,388,606 (GRCm39) missense probably benign 0.00
R0426:Kank1 UTSW 19 25,388,837 (GRCm39) missense probably damaging 1.00
R0483:Kank1 UTSW 19 25,403,357 (GRCm39) unclassified probably benign
R1394:Kank1 UTSW 19 25,405,528 (GRCm39) missense probably damaging 1.00
R1495:Kank1 UTSW 19 25,387,713 (GRCm39) missense probably damaging 0.98
R1681:Kank1 UTSW 19 25,387,668 (GRCm39) missense possibly damaging 0.89
R1698:Kank1 UTSW 19 25,388,681 (GRCm39) missense probably benign 0.11
R1830:Kank1 UTSW 19 25,388,396 (GRCm39) missense probably benign 0.00
R1866:Kank1 UTSW 19 25,388,813 (GRCm39) missense probably benign 0.04
R2138:Kank1 UTSW 19 25,389,117 (GRCm39) missense probably benign 0.00
R2139:Kank1 UTSW 19 25,389,117 (GRCm39) missense probably benign 0.00
R2420:Kank1 UTSW 19 25,387,821 (GRCm39) missense probably damaging 1.00
R3153:Kank1 UTSW 19 25,388,052 (GRCm39) missense possibly damaging 0.89
R4164:Kank1 UTSW 19 25,388,436 (GRCm39) missense probably benign 0.10
R4670:Kank1 UTSW 19 25,387,944 (GRCm39) missense probably benign 0.00
R4685:Kank1 UTSW 19 25,387,398 (GRCm39) missense possibly damaging 0.66
R4843:Kank1 UTSW 19 25,408,371 (GRCm39) missense probably damaging 1.00
R4981:Kank1 UTSW 19 25,388,759 (GRCm39) missense probably benign 0.19
R5189:Kank1 UTSW 19 25,401,545 (GRCm39) missense probably damaging 1.00
R5280:Kank1 UTSW 19 25,388,669 (GRCm39) missense probably benign 0.01
R5330:Kank1 UTSW 19 25,388,693 (GRCm39) missense probably damaging 1.00
R5331:Kank1 UTSW 19 25,388,693 (GRCm39) missense probably damaging 1.00
R5435:Kank1 UTSW 19 25,388,507 (GRCm39) missense probably benign 0.04
R5500:Kank1 UTSW 19 25,401,696 (GRCm39) missense possibly damaging 0.46
R5894:Kank1 UTSW 19 25,401,564 (GRCm39) missense probably damaging 1.00
R6087:Kank1 UTSW 19 25,387,088 (GRCm39) missense probably benign 0.41
R6357:Kank1 UTSW 19 25,388,717 (GRCm39) missense probably benign 0.36
R6490:Kank1 UTSW 19 25,387,449 (GRCm39) missense probably damaging 1.00
R6504:Kank1 UTSW 19 25,405,518 (GRCm39) missense probably damaging 1.00
R6942:Kank1 UTSW 19 25,401,537 (GRCm39) missense possibly damaging 0.88
R7037:Kank1 UTSW 19 25,407,705 (GRCm39) missense probably damaging 1.00
R7405:Kank1 UTSW 19 25,387,683 (GRCm39) nonsense probably null
R7486:Kank1 UTSW 19 25,388,193 (GRCm39) missense probably damaging 0.99
R7602:Kank1 UTSW 19 25,399,525 (GRCm39) missense probably benign 0.01
R7701:Kank1 UTSW 19 25,389,129 (GRCm39) critical splice donor site probably null
R7765:Kank1 UTSW 19 25,388,569 (GRCm39) frame shift probably null
R7766:Kank1 UTSW 19 25,388,569 (GRCm39) frame shift probably null
R7768:Kank1 UTSW 19 25,388,569 (GRCm39) frame shift probably null
R7919:Kank1 UTSW 19 25,408,439 (GRCm39) missense probably damaging 1.00
R7974:Kank1 UTSW 19 25,401,584 (GRCm39) missense probably damaging 1.00
R8017:Kank1 UTSW 19 25,388,569 (GRCm39) frame shift probably null
R8017:Kank1 UTSW 19 25,388,568 (GRCm39) frame shift probably null
R8020:Kank1 UTSW 19 25,388,569 (GRCm39) frame shift probably null
R8150:Kank1 UTSW 19 25,388,163 (GRCm39) missense possibly damaging 0.88
R8322:Kank1 UTSW 19 25,355,842 (GRCm39) start gained probably benign
R8374:Kank1 UTSW 19 25,389,005 (GRCm39) missense probably damaging 0.97
R8705:Kank1 UTSW 19 25,388,907 (GRCm39) missense probably damaging 1.00
R8855:Kank1 UTSW 19 25,388,702 (GRCm39) missense possibly damaging 0.87
R8866:Kank1 UTSW 19 25,388,702 (GRCm39) missense possibly damaging 0.87
R8891:Kank1 UTSW 19 25,387,439 (GRCm39) missense probably benign 0.32
R8894:Kank1 UTSW 19 25,408,378 (GRCm39) missense probably damaging 1.00
R8917:Kank1 UTSW 19 25,386,928 (GRCm39) missense probably damaging 0.99
R9217:Kank1 UTSW 19 25,386,944 (GRCm39) missense possibly damaging 0.92
R9301:Kank1 UTSW 19 25,388,798 (GRCm39) missense probably benign 0.00
R9431:Kank1 UTSW 19 25,387,866 (GRCm39) missense probably damaging 1.00
R9603:Kank1 UTSW 19 25,408,289 (GRCm39) missense possibly damaging 0.95
R9680:Kank1 UTSW 19 25,388,138 (GRCm39) missense probably damaging 1.00
R9746:Kank1 UTSW 19 25,386,872 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGATTGTCTGCTTCCCCAAG -3'
(R):5'- CCGCATTTTGAGACCAACTAG -3'

Sequencing Primer
(F):5'- ATTGTCTGCTTCCCCAAGGAGTG -3'
(R):5'- CAGAATTGCCAGACAGCA -3'
Posted On 2020-09-15