Mutagenetix > Incidental Mutation

Incidental Mutation 'R7979:Raph1'

651058

Institutional Source

Beutler Lab

Gene Symbol

Raph1

Ensembl Gene

ENSMUSG00000026014

Gene Name

Ras association (RalGDS/AF-6) and pleckstrin homology domains 1

Synonyms

C730009O10Rik, Lpd, 9430025M21Rik, lamellipodin

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.120) question?

Stock #

R7979 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

60482292-60567104 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 60525989 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Isoleucine at position 113 (T113I)

Ref Sequence

ENSEMBL: ENSMUSP00000120638 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027168] [ENSMUST00000090293] [ENSMUST00000140485] [ENSMUST00000142258]

AlphaFold

F2Z3U3

Predicted Effect

probably benign
Transcript: ENSMUST00000027168
AA Change: T113I

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)

SMART Domains

Protein: ENSMUSP00000027168
Gene: ENSMUSG00000026014
AA Change: T113I

Domain	Start	End	E-Value	Type
low complexity region	201	218	N/A	INTRINSIC
low complexity region	294	308	N/A	INTRINSIC
RA	322	408	1.63e-13	SMART
PH	450	560	3.38e-11	SMART
low complexity region	581	604	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000090293
AA Change: T113I

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)

SMART Domains

Protein: ENSMUSP00000087763
Gene: ENSMUSG00000026014
AA Change: T113I

Domain	Start	End	E-Value	Type
low complexity region	201	218	N/A	INTRINSIC
low complexity region	294	308	N/A	INTRINSIC
RA	322	408	1.63e-13	SMART
PH	450	560	3.38e-11	SMART
low complexity region	581	604	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000140485
AA Change: T113I

SMART Domains

Protein: ENSMUSP00000121023
Gene: ENSMUSG00000026014
AA Change: T113I

Domain	Start	End	E-Value	Type
low complexity region	201	218	N/A	INTRINSIC
low complexity region	245	256	N/A	INTRINSIC
RA	270	356	1.63e-13	SMART
PH	398	508	3.38e-11	SMART
low complexity region	529	552	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000142258
AA Change: T113I

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)

SMART Domains

Protein: ENSMUSP00000120638
Gene: ENSMUSG00000026014
AA Change: T113I

Domain	Start	End	E-Value	Type
low complexity region	202	212	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the Mig10/Rap1-interacting adaptor molecule/Lamellipodin family of adapter proteins, which function in cell migration. Members of this family contain pleckstrin-homology domains, Ras-association domains, and proline-rich C-termini. The protein encoded by this gene regulates actin dynamics through interaction with Ena/Vasodilator proteins as well as direct binding to filamentous actin to regulate actin network assembly. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for a conditional allele activated in all cells exhibit background sensitive neonatal or postnatal lethality, decreased body size, belly spotting and decreased melanocyte numbers in the trunk. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9230110C19Rik	T	A	9: 8,027,110	E142D	possibly damaging	Het
Adam22	A	T	5: 8,136,804		probably null	Het
Ahnak	A	T	19: 9,011,432	D3360V	probably damaging	Het
Akap9	T	C	5: 4,050,381	L2681P	probably benign	Het
Ankrd52	C	A	10: 128,381,988	A279E	probably damaging	Het
Arhgef4	T	C	1: 34,721,897	L78P	unknown	Het
Chpf	A	T	1: 75,477,260	C291*	probably null	Het
Cr1l	T	C	1: 195,117,722	T215A	probably damaging	Het
Ctc1	A	T	11: 69,027,383	K444*	probably null	Het
Dscaml1	T	C	9: 45,683,731	S711P	probably damaging	Het
Elavl4	A	T	4: 110,211,648	V176D	probably benign	Het
Faim2	A	G	15: 99,510,634	V251A	possibly damaging	Het
Fancg	A	G	4: 43,004,963	I410T	probably damaging	Het
Frmd3	G	A	4: 74,153,615	V245I	probably damaging	Het
Gls	T	C	1: 52,191,112	H480R	probably damaging	Het
Gm30191	A	G	4: 134,249,912	D145G	possibly damaging	Het
Grik2	T	C	10: 49,404,342	I438V	probably benign	Het
Klhl3	G	T	13: 58,063,797	Q197K	probably benign	Het
Krt42	G	C	11: 100,265,039	R294G	possibly damaging	Het
Mmp23	G	A	4: 155,652,005	T193I	possibly damaging	Het
Mmrn1	T	C	6: 60,975,977	V414A	probably damaging	Het
Mmrn2	C	T	14: 34,396,181	Q61*	probably null	Het
Mprip	G	A	11: 59,766,856	R852H	probably damaging	Het
Nars2	A	C	7: 97,062,661	N461T	probably damaging	Het
Nomo1	A	G	7: 46,041,562	N124S	probably null	Het
Olfr23	G	T	11: 73,940,575	V110F	probably benign	Het
Olfr346	A	G	2: 36,688,094	I31V	probably benign	Het
Peak1	T	A	9: 56,207,392	N1422Y	possibly damaging	Het
Perm1	TGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCT	TGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCT	4: 156,218,068		probably benign	Het
Pfkm	G	A	15: 98,128,236	E571K	probably damaging	Het
Ptpn2	A	T	18: 67,681,571	C123S	possibly damaging	Het
Rsf1	A	G	7: 97,685,713	E1351G		Het
Serinc4	C	T	2: 121,455,312	V163I	probably benign	Het
Slc7a2	G	T	8: 40,904,504	G270C	probably damaging	Het
Smc2	G	A	4: 52,450,857	R225Q	probably damaging	Het
Tas2r137	T	C	6: 40,491,667	S144P	probably damaging	Het
Tcl1b4	A	T	12: 105,202,606	H43L	probably benign	Het
Tmem156	T	C	5: 65,080,009	T103A	possibly damaging	Het
Tns3	A	T	11: 8,492,701	M554K	probably benign	Het
Tpp2	A	T	1: 43,940,137	I65F	probably benign	Het
Trank1	T	A	9: 111,377,899	M1700K	probably benign	Het
Ttc39c	T	A	18: 12,732,965	H473Q	probably benign	Het
Vmn2r68	A	C	7: 85,234,417		probably null	Het
Wnk1	T	C	6: 120,037,448	D62G	probably damaging	Het
Wnk2	A	T	13: 49,095,408	M389K	probably damaging	Het
Zfp292	G	A	4: 34,809,198	T1287M	probably benign	Het
Zfp451	G	A	1: 33,782,138	S211L	probably benign	Het
Zfp710	T	C	7: 80,088,579	S626P	unknown	Het
Zfp787	C	T	7: 6,143,095	E16K	probably damaging	Het
Zfp788	G	T	7: 41,634,900		probably null	Het

Other mutations in Raph1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02300:Raph1	APN	1	60525947	missense	possibly damaging	0.76
IGL02900:Raph1	APN	1	60502863	missense	probably damaging	1.00
FR4976:Raph1	UTSW	1	60489267	intron	probably benign
R0048:Raph1	UTSW	1	60500605	missense	probably benign	0.03
R0048:Raph1	UTSW	1	60500605	missense	probably benign	0.03
R0049:Raph1	UTSW	1	60525899	missense	probably benign	0.03
R0049:Raph1	UTSW	1	60525899	missense	probably benign	0.03
R0227:Raph1	UTSW	1	60525977	missense	probably benign	0.00
R0387:Raph1	UTSW	1	60510496	intron	probably benign
R0607:Raph1	UTSW	1	60525869	missense	probably damaging	1.00
R1740:Raph1	UTSW	1	60519024	nonsense	probably null
R2274:Raph1	UTSW	1	60498500	missense	probably damaging	1.00
R3108:Raph1	UTSW	1	60493386	missense	probably benign	0.01
R3977:Raph1	UTSW	1	60498523	missense	probably benign	0.39
R4260:Raph1	UTSW	1	60502965	missense	possibly damaging	0.94
R4487:Raph1	UTSW	1	60502869	missense	possibly damaging	0.68
R4721:Raph1	UTSW	1	60503001	unclassified	probably benign
R4782:Raph1	UTSW	1	60489114	missense	probably damaging	1.00
R5027:Raph1	UTSW	1	60496277	missense	probably damaging	1.00
R5037:Raph1	UTSW	1	60496222	splice site	probably null
R5106:Raph1	UTSW	1	60533300	missense	probably damaging	1.00
R5506:Raph1	UTSW	1	60493498	intron	probably benign
R5510:Raph1	UTSW	1	60522946	unclassified	probably benign
R5587:Raph1	UTSW	1	60498473	missense	probably damaging	1.00
R5591:Raph1	UTSW	1	60501746	unclassified	probably benign
R5619:Raph1	UTSW	1	60490255	intron	probably benign
R5776:Raph1	UTSW	1	60490156	intron	probably benign
R5802:Raph1	UTSW	1	60488673	missense	possibly damaging	0.81
R6742:Raph1	UTSW	1	60525720	missense	probably damaging	0.97
R7122:Raph1	UTSW	1	60525977	missense	probably benign	0.10
R7219:Raph1	UTSW	1	60502873	missense	unknown
R7251:Raph1	UTSW	1	60489868	missense	unknown
R7254:Raph1	UTSW	1	60499608	missense	unknown
R7732:Raph1	UTSW	1	60533288	missense	possibly damaging	0.82
R7986:Raph1	UTSW	1	60496286	missense
R8167:Raph1	UTSW	1	60490111	missense	unknown
R8168:Raph1	UTSW	1	60499620	missense	unknown
R8399:Raph1	UTSW	1	60489318	missense	unknown
R9036:Raph1	UTSW	1	60502965	missense	unknown
R9146:Raph1	UTSW	1	60518978	critical splice donor site	probably null
R9338:Raph1	UTSW	1	60490141	missense	unknown
R9381:Raph1	UTSW	1	60501800	missense	unknown
R9383:Raph1	UTSW	1	60525670	missense	unknown
R9399:Raph1	UTSW	1	60525995	missense	probably benign
R9454:Raph1	UTSW	1	60489594	missense	unknown
R9561:Raph1	UTSW	1	60525728	missense	possibly damaging	0.49
RF018:Raph1	UTSW	1	60489267	intron	probably benign
RF022:Raph1	UTSW	1	60489267	intron	probably benign

Predicted Primers

PCR Primer
(F):5'- CATCCATGCTCAAGGAAGCC -3'
(R):5'- TTACCAGAGATCTTAAAGGATAGGC -3'

Sequencing Primer
(F):5'- ATGCTCAAGGAAGCCTGTTC -3'
(R):5'- GAATCAGGGTGAGACTGT -3'

Posted On

2020-09-15