Incidental Mutation 'R7979:Tmem156'
ID651073
Institutional Source Beutler Lab
Gene Symbol Tmem156
Ensembl Gene ENSMUSG00000037913
Gene Nametransmembrane protein 156
SynonymsLOC243025
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock #R7979 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location65054346-65092132 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 65080009 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 103 (T103A)
Ref Sequence ENSEMBL: ENSMUSP00000148480 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043352] [ENSMUST00000212080] [ENSMUST00000212194] [ENSMUST00000212640]
Predicted Effect probably benign
Transcript: ENSMUST00000043352
AA Change: T91A

PolyPhen 2 Score 0.357 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000044102
Gene: ENSMUSG00000037913
AA Change: T91A

DomainStartEndE-ValueType
transmembrane domain 5 22 N/A INTRINSIC
Pfam:TMEM156 39 264 1.2e-111 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000212080
AA Change: T103A

PolyPhen 2 Score 0.473 (Sensitivity: 0.89; Specificity: 0.90)
Predicted Effect possibly damaging
Transcript: ENSMUST00000212194
AA Change: T68A

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
Predicted Effect probably benign
Transcript: ENSMUST00000212640
AA Change: T68A

PolyPhen 2 Score 0.249 (Sensitivity: 0.91; Specificity: 0.88)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9230110C19Rik T A 9: 8,027,110 E142D possibly damaging Het
Adam22 A T 5: 8,136,804 probably null Het
Ahnak A T 19: 9,011,432 D3360V probably damaging Het
Akap9 T C 5: 4,050,381 L2681P probably benign Het
Ankrd52 C A 10: 128,381,988 A279E probably damaging Het
Arhgef4 T C 1: 34,721,897 L78P unknown Het
Chpf A T 1: 75,477,260 C291* probably null Het
Cr1l T C 1: 195,117,722 T215A probably damaging Het
Ctc1 A T 11: 69,027,383 K444* probably null Het
Dscaml1 T C 9: 45,683,731 S711P probably damaging Het
Elavl4 A T 4: 110,211,648 V176D probably benign Het
Faim2 A G 15: 99,510,634 V251A possibly damaging Het
Fancg A G 4: 43,004,963 I410T probably damaging Het
Frmd3 G A 4: 74,153,615 V245I probably damaging Het
Gls T C 1: 52,191,112 H480R probably damaging Het
Gm30191 A G 4: 134,249,912 D145G possibly damaging Het
Grik2 T C 10: 49,404,342 I438V probably benign Het
Klhl3 G T 13: 58,063,797 Q197K probably benign Het
Krt42 G C 11: 100,265,039 R294G possibly damaging Het
Mmp23 G A 4: 155,652,005 T193I possibly damaging Het
Mmrn1 T C 6: 60,975,977 V414A probably damaging Het
Mmrn2 C T 14: 34,396,181 Q61* probably null Het
Mprip G A 11: 59,766,856 R852H probably damaging Het
Nars2 A C 7: 97,062,661 N461T probably damaging Het
Nomo1 A G 7: 46,041,562 N124S probably null Het
Olfr23 G T 11: 73,940,575 V110F probably benign Het
Olfr346 A G 2: 36,688,094 I31V probably benign Het
Peak1 T A 9: 56,207,392 N1422Y possibly damaging Het
Perm1 TGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCT TGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCT 4: 156,218,068 probably benign Het
Pfkm G A 15: 98,128,236 E571K probably damaging Het
Ptpn2 A T 18: 67,681,571 C123S possibly damaging Het
Raph1 G A 1: 60,525,989 T113I probably benign Het
Rsf1 A G 7: 97,685,713 E1351G Het
Serinc4 C T 2: 121,455,312 V163I probably benign Het
Slc7a2 G T 8: 40,904,504 G270C probably damaging Het
Smc2 G A 4: 52,450,857 R225Q probably damaging Het
Tas2r137 T C 6: 40,491,667 S144P probably damaging Het
Tcl1b4 A T 12: 105,202,606 H43L probably benign Het
Tns3 A T 11: 8,492,701 M554K probably benign Het
Tpp2 A T 1: 43,940,137 I65F probably benign Het
Trank1 T A 9: 111,377,899 M1700K probably benign Het
Ttc39c T A 18: 12,732,965 H473Q probably benign Het
Vmn2r68 A C 7: 85,234,417 probably null Het
Wnk1 T C 6: 120,037,448 D62G probably damaging Het
Wnk2 A T 13: 49,095,408 M389K probably damaging Het
Zfp292 G A 4: 34,809,198 T1287M probably benign Het
Zfp451 G A 1: 33,782,138 S211L probably benign Het
Zfp710 T C 7: 80,088,579 S626P unknown Het
Zfp787 C T 7: 6,143,095 E16K probably damaging Het
Zfp788 G T 7: 41,634,900 probably null Het
Other mutations in Tmem156
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00538:Tmem156 APN 5 65073840 missense probably damaging 1.00
IGL01064:Tmem156 APN 5 65079984 missense probably damaging 0.99
IGL01330:Tmem156 APN 5 65080182 missense probably benign 0.17
IGL03336:Tmem156 APN 5 65075764 missense probably benign 0.01
IGL03383:Tmem156 APN 5 65075697 missense probably damaging 0.98
R0526:Tmem156 UTSW 5 65075818 missense probably benign 0.02
R2006:Tmem156 UTSW 5 65079951 missense probably damaging 1.00
R4721:Tmem156 UTSW 5 65091527 missense probably benign 0.10
R4773:Tmem156 UTSW 5 65080159 missense probably damaging 1.00
R4810:Tmem156 UTSW 5 65091447 intron probably benign
R4910:Tmem156 UTSW 5 65091462 intron probably benign
R5148:Tmem156 UTSW 5 65073768 missense probably benign 0.00
R5510:Tmem156 UTSW 5 65075574 missense probably benign 0.02
R5809:Tmem156 UTSW 5 65075607 missense possibly damaging 0.55
R6033:Tmem156 UTSW 5 65075621 missense probably benign 0.35
R6033:Tmem156 UTSW 5 65075621 missense probably benign 0.35
R7731:Tmem156 UTSW 5 65075562 critical splice donor site probably null
R7772:Tmem156 UTSW 5 65080174 missense probably damaging 1.00
R7788:Tmem156 UTSW 5 65075569 missense possibly damaging 0.47
R8017:Tmem156 UTSW 5 65073861 missense probably damaging 1.00
R8132:Tmem156 UTSW 5 65075755 missense probably benign 0.00
R8249:Tmem156 UTSW 5 65075626 nonsense probably null
RF020:Tmem156 UTSW 5 65091547 missense probably benign 0.34
Predicted Primers PCR Primer
(F):5'- TGGAATGGTTGCTTTCCCC -3'
(R):5'- CGAGGAACTACGAAGAGCTTAC -3'

Sequencing Primer
(F):5'- CCACCCCCAAGAACAACTTAATTTAG -3'
(R):5'- TTTCTCTGCAGAAAGAACCCGTG -3'
Posted On2020-09-15