Incidental Mutation 'R7979:Vmn2r68'
ID 651081
Institutional Source Beutler Lab
Gene Symbol Vmn2r68
Ensembl Gene ENSMUSG00000096861
Gene Name vomeronasal 2, receptor 68
Synonyms Vmn2r68-ps, EG620697
Accession Numbers
Essential gene? Probably non essential (E-score: 0.124) question?
Stock # R7979 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 85221518-85237704 bp(-) (GRCm38)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to C at 85234417 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000129411 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061074]
AlphaFold L7N2B3
Predicted Effect probably null
Transcript: ENSMUST00000061074
SMART Domains Protein: ENSMUSP00000129411
Gene: ENSMUSG00000096861

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 77 463 4.5e-28 PFAM
Pfam:NCD3G 507 559 1.1e-18 PFAM
Pfam:7tm_3 589 827 3.7e-53 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9230110C19Rik T A 9: 8,027,110 E142D possibly damaging Het
Adam22 A T 5: 8,136,804 probably null Het
Ahnak A T 19: 9,011,432 D3360V probably damaging Het
Akap9 T C 5: 4,050,381 L2681P probably benign Het
Ankrd52 C A 10: 128,381,988 A279E probably damaging Het
Arhgef4 T C 1: 34,721,897 L78P unknown Het
Chpf A T 1: 75,477,260 C291* probably null Het
Cr1l T C 1: 195,117,722 T215A probably damaging Het
Ctc1 A T 11: 69,027,383 K444* probably null Het
Dscaml1 T C 9: 45,683,731 S711P probably damaging Het
Elavl4 A T 4: 110,211,648 V176D probably benign Het
Faim2 A G 15: 99,510,634 V251A possibly damaging Het
Fancg A G 4: 43,004,963 I410T probably damaging Het
Frmd3 G A 4: 74,153,615 V245I probably damaging Het
Gls T C 1: 52,191,112 H480R probably damaging Het
Gm30191 A G 4: 134,249,912 D145G possibly damaging Het
Grik2 T C 10: 49,404,342 I438V probably benign Het
Klhl3 G T 13: 58,063,797 Q197K probably benign Het
Krt42 G C 11: 100,265,039 R294G possibly damaging Het
Mmp23 G A 4: 155,652,005 T193I possibly damaging Het
Mmrn1 T C 6: 60,975,977 V414A probably damaging Het
Mmrn2 C T 14: 34,396,181 Q61* probably null Het
Mprip G A 11: 59,766,856 R852H probably damaging Het
Nars2 A C 7: 97,062,661 N461T probably damaging Het
Nomo1 A G 7: 46,041,562 N124S probably null Het
Olfr23 G T 11: 73,940,575 V110F probably benign Het
Olfr346 A G 2: 36,688,094 I31V probably benign Het
Peak1 T A 9: 56,207,392 N1422Y possibly damaging Het
Perm1 TGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCT TGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCT 4: 156,218,068 probably benign Het
Pfkm G A 15: 98,128,236 E571K probably damaging Het
Ptpn2 A T 18: 67,681,571 C123S possibly damaging Het
Raph1 G A 1: 60,525,989 T113I probably benign Het
Rsf1 A G 7: 97,685,713 E1351G Het
Serinc4 C T 2: 121,455,312 V163I probably benign Het
Slc7a2 G T 8: 40,904,504 G270C probably damaging Het
Smc2 G A 4: 52,450,857 R225Q probably damaging Het
Tas2r137 T C 6: 40,491,667 S144P probably damaging Het
Tcl1b4 A T 12: 105,202,606 H43L probably benign Het
Tmem156 T C 5: 65,080,009 T103A possibly damaging Het
Tns3 A T 11: 8,492,701 M554K probably benign Het
Tpp2 A T 1: 43,940,137 I65F probably benign Het
Trank1 T A 9: 111,377,899 M1700K probably benign Het
Ttc39c T A 18: 12,732,965 H473Q probably benign Het
Wnk1 T C 6: 120,037,448 D62G probably damaging Het
Wnk2 A T 13: 49,095,408 M389K probably damaging Het
Zfp292 G A 4: 34,809,198 T1287M probably benign Het
Zfp451 G A 1: 33,782,138 S211L probably benign Het
Zfp710 T C 7: 80,088,579 S626P unknown Het
Zfp787 C T 7: 6,143,095 E16K probably damaging Het
Zfp788 G T 7: 41,634,900 probably null Het
Other mutations in Vmn2r68
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01391:Vmn2r68 APN 7 85237611 missense probably benign
IGL01477:Vmn2r68 APN 7 85233483 missense probably damaging 1.00
IGL01600:Vmn2r68 APN 7 85222260 missense probably benign 0.39
IGL01979:Vmn2r68 APN 7 85222117 missense probably benign
IGL01999:Vmn2r68 APN 7 85222231 missense probably damaging 1.00
IGL02269:Vmn2r68 APN 7 85221739 missense possibly damaging 0.84
IGL02517:Vmn2r68 APN 7 85221945 nonsense probably null
IGL02827:Vmn2r68 APN 7 85237592 missense probably damaging 1.00
IGL02852:Vmn2r68 APN 7 85233387 missense probably damaging 1.00
IGL02982:Vmn2r68 APN 7 85234441 missense probably benign 0.12
IGL03099:Vmn2r68 APN 7 85222240 nonsense probably null
IGL03166:Vmn2r68 APN 7 85222123 missense probably benign 0.01
IGL03168:Vmn2r68 APN 7 85221764 missense probably damaging 1.00
IGL03243:Vmn2r68 APN 7 85233755 missense possibly damaging 0.66
F5770:Vmn2r68 UTSW 7 85221880 missense probably benign 0.01
R0280:Vmn2r68 UTSW 7 85233249 splice site probably benign
R0280:Vmn2r68 UTSW 7 85233258 critical splice donor site probably null
R0281:Vmn2r68 UTSW 7 85233249 splice site probably benign
R0281:Vmn2r68 UTSW 7 85233258 critical splice donor site probably null
R0348:Vmn2r68 UTSW 7 85221676 missense possibly damaging 0.50
R0390:Vmn2r68 UTSW 7 85233249 splice site probably benign
R0390:Vmn2r68 UTSW 7 85233258 critical splice donor site probably null
R0722:Vmn2r68 UTSW 7 85221586 missense possibly damaging 0.95
R1129:Vmn2r68 UTSW 7 85237504 splice site probably null
R1136:Vmn2r68 UTSW 7 85222341 missense possibly damaging 0.81
R1319:Vmn2r68 UTSW 7 85232492 missense probably damaging 0.96
R1614:Vmn2r68 UTSW 7 85221738 missense possibly damaging 0.93
R1682:Vmn2r68 UTSW 7 85233366 missense possibly damaging 0.68
R1837:Vmn2r68 UTSW 7 85233678 missense probably damaging 0.96
R1893:Vmn2r68 UTSW 7 85234659 nonsense probably null
R1908:Vmn2r68 UTSW 7 85234052 missense probably benign 0.09
R1909:Vmn2r68 UTSW 7 85234052 missense probably benign 0.09
R1951:Vmn2r68 UTSW 7 85233894 missense probably damaging 1.00
R2177:Vmn2r68 UTSW 7 85221915 missense probably benign 0.01
R2178:Vmn2r68 UTSW 7 85221550 frame shift probably null
R2185:Vmn2r68 UTSW 7 85233693 nonsense probably null
R2188:Vmn2r68 UTSW 7 85221550 frame shift probably null
R2282:Vmn2r68 UTSW 7 85221651 missense possibly damaging 0.65
R2567:Vmn2r68 UTSW 7 85234595 missense probably benign
R2869:Vmn2r68 UTSW 7 85233626 missense probably benign 0.25
R2869:Vmn2r68 UTSW 7 85233626 missense probably benign 0.25
R2870:Vmn2r68 UTSW 7 85233626 missense probably benign 0.25
R2870:Vmn2r68 UTSW 7 85233626 missense probably benign 0.25
R2871:Vmn2r68 UTSW 7 85233626 missense probably benign 0.25
R2871:Vmn2r68 UTSW 7 85233626 missense probably benign 0.25
R2873:Vmn2r68 UTSW 7 85233626 missense probably benign 0.25
R2874:Vmn2r68 UTSW 7 85233626 missense probably benign 0.25
R3149:Vmn2r68 UTSW 7 85237667 missense probably benign 0.00
R3401:Vmn2r68 UTSW 7 85221550 frame shift probably null
R3978:Vmn2r68 UTSW 7 85232462 missense probably benign 0.00
R4399:Vmn2r68 UTSW 7 85221550 frame shift probably null
R4401:Vmn2r68 UTSW 7 85221550 frame shift probably null
R4421:Vmn2r68 UTSW 7 85221550 frame shift probably null
R4478:Vmn2r68 UTSW 7 85221550 frame shift probably null
R4479:Vmn2r68 UTSW 7 85221550 frame shift probably null
R4495:Vmn2r68 UTSW 7 85221550 frame shift probably null
R4628:Vmn2r68 UTSW 7 85234465 missense probably benign 0.00
R4649:Vmn2r68 UTSW 7 85221535 missense probably benign
R4654:Vmn2r68 UTSW 7 85233561 nonsense probably null
R4793:Vmn2r68 UTSW 7 85234440 missense probably benign 0.01
R5007:Vmn2r68 UTSW 7 85232414 missense probably benign
R5021:Vmn2r68 UTSW 7 85233734 missense possibly damaging 0.62
R5082:Vmn2r68 UTSW 7 85233868 missense probably benign 0.12
R5177:Vmn2r68 UTSW 7 85221991 missense probably damaging 0.99
R5221:Vmn2r68 UTSW 7 85221877 missense probably damaging 1.00
R5514:Vmn2r68 UTSW 7 85237559 missense possibly damaging 0.92
R5521:Vmn2r68 UTSW 7 85233718 missense probably benign 0.03
R5563:Vmn2r68 UTSW 7 85222075 missense probably damaging 1.00
R5664:Vmn2r68 UTSW 7 85233770 missense probably benign 0.02
R5829:Vmn2r68 UTSW 7 85237604 missense probably benign 0.00
R6016:Vmn2r68 UTSW 7 85222245 missense probably damaging 0.99
R6356:Vmn2r68 UTSW 7 85233840 missense possibly damaging 0.85
R6413:Vmn2r68 UTSW 7 85221765 missense probably damaging 1.00
R6418:Vmn2r68 UTSW 7 85233707 missense probably benign
R6699:Vmn2r68 UTSW 7 85232375 missense possibly damaging 0.58
R7287:Vmn2r68 UTSW 7 85222252 missense probably benign 0.33
R7319:Vmn2r68 UTSW 7 85233834 missense probably benign
R7374:Vmn2r68 UTSW 7 85232399 missense possibly damaging 0.66
R7585:Vmn2r68 UTSW 7 85232379 missense probably damaging 1.00
R7605:Vmn2r68 UTSW 7 85233908 missense probably benign 0.01
R7892:Vmn2r68 UTSW 7 85234514 missense probably benign
R8177:Vmn2r68 UTSW 7 85222214 nonsense probably null
R8349:Vmn2r68 UTSW 7 85233577 missense probably damaging 1.00
R8378:Vmn2r68 UTSW 7 85221900 missense probably benign 0.00
R8397:Vmn2r68 UTSW 7 85237514 missense possibly damaging 0.71
R8449:Vmn2r68 UTSW 7 85233577 missense probably damaging 1.00
R8543:Vmn2r68 UTSW 7 85234440 missense probably benign 0.01
R8680:Vmn2r68 UTSW 7 85222113 missense possibly damaging 0.68
R9056:Vmn2r68 UTSW 7 85222212 missense possibly damaging 0.71
R9342:Vmn2r68 UTSW 7 85233785 missense probably benign 0.39
R9734:Vmn2r68 UTSW 7 85233549 missense possibly damaging 0.54
V7581:Vmn2r68 UTSW 7 85221880 missense probably benign 0.01
Z1176:Vmn2r68 UTSW 7 85221733 missense probably damaging 1.00
Z1176:Vmn2r68 UTSW 7 85222081 missense probably benign 0.27
Z1176:Vmn2r68 UTSW 7 85222099 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- CATTTCACAATGCTGCTGCC -3'
(R):5'- CCCAAGACCAACCATTTGATTTTC -3'

Sequencing Primer
(F):5'- GCCTCCCATACCCATTTATGATAAAG -3'
(R):5'- CTCTGTTTATCTTGCCTTGGATG -3'
Posted On 2020-09-15