Incidental Mutation 'R7980:Mgat5'
ID 651108
Institutional Source Beutler Lab
Gene Symbol Mgat5
Ensembl Gene ENSMUSG00000036155
Gene Name mannoside acetylglucosaminyltransferase 5
Synonyms 4930471A21Rik, 5330407H02Rik, GlcNAc-TV, beta1,6N-acetylglucosaminyltransferase V
MMRRC Submission 046021-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7980 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 127132450-127413760 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 127407248 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Arginine at position 638 (Q638R)
Ref Sequence ENSEMBL: ENSMUSP00000038359 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038361] [ENSMUST00000171405]
AlphaFold Q8R4G6
Predicted Effect probably benign
Transcript: ENSMUST00000038361
AA Change: Q638R

PolyPhen 2 Score 0.132 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000038359
Gene: ENSMUSG00000036155
AA Change: Q638R

DomainStartEndE-ValueType
Pfam:DUF4525 2 138 3.4e-70 PFAM
Pfam:Glyco_transf_18 171 725 9.8e-268 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171405
AA Change: Q638R

PolyPhen 2 Score 0.132 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000129166
Gene: ENSMUSG00000036155
AA Change: Q638R

DomainStartEndE-ValueType
Pfam:DUF4525 3 137 9.3e-64 PFAM
Pfam:Glyco_transf_18 171 725 1.9e-268 PFAM
Meta Mutation Damage Score 0.0727 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (87/87)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the glycosyltransferase family. It catalyzes the addition of beta-1,6-N-acetylglucosamine to the alpha-linked mannose of biantennary N-linked oligosaccharides present on the newly synthesized glycoproteins. It is one of the most important enzymes involved in the regulation of the biosynthesis of glycoprotein oligosaccharides. Alterations of the oligosaccharides on cell surface glycoproteins cause significant changes in the adhesive or migratory behavior of a cell. Increase in the activity of this enzyme has been correlated with the progression of invasive malignancies. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for deficiencies in this gene have immune system abnormalities and reduced cancer growth and metastasis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930553M12Rik A G 4: 88,786,315 (GRCm39) L101P unknown Het
Actn3 G A 19: 4,917,950 (GRCm39) P339L probably damaging Het
Adamts12 G A 15: 11,263,423 (GRCm39) C595Y probably damaging Het
Adrm1b T A 3: 92,336,406 (GRCm39) K99* probably null Het
Agl A T 3: 116,585,830 (GRCm39) N99K probably benign Het
Aplp1 A T 7: 30,134,992 (GRCm39) M592K probably benign Het
Arhgef11 C T 3: 87,605,297 (GRCm39) R251C probably benign Het
Arhgef12 A T 9: 42,882,595 (GRCm39) C1416* probably null Het
Asah1 A G 8: 41,807,067 (GRCm39) M119T Het
Asxl2 A T 12: 3,546,630 (GRCm39) Q471H probably damaging Het
Atp6v1c2 A T 12: 17,371,613 (GRCm39) D61E probably damaging Het
Btbd16 C A 7: 130,426,097 (GRCm39) P520Q probably damaging Het
Cacnb2 A G 2: 14,609,326 (GRCm39) E22G probably benign Het
Catspere2 G T 1: 177,830,610 (GRCm39) probably null Het
Cdc25a T A 9: 109,708,949 (GRCm39) D124E probably damaging Het
Cdc42se1 A T 3: 95,139,166 (GRCm39) probably benign Het
Cdcp3 T A 7: 130,836,506 (GRCm39) V400E probably damaging Het
Cfap54 T C 10: 92,817,922 (GRCm39) K1265E possibly damaging Het
Chaf1b A G 16: 93,681,415 (GRCm39) H11R probably damaging Het
Chil4 T C 3: 106,110,060 (GRCm39) K345E probably damaging Het
Cntnap1 A G 11: 101,079,719 (GRCm39) I1283V probably benign Het
Dagla C T 19: 10,229,406 (GRCm39) C618Y possibly damaging Het
Ddx19b C T 8: 111,738,077 (GRCm39) V224M possibly damaging Het
Dohh C T 10: 81,223,726 (GRCm39) R260* probably null Het
Dsg3 A T 18: 20,664,417 (GRCm39) N472Y probably benign Het
Duox1 T A 2: 122,177,801 (GRCm39) N1528K possibly damaging Het
Eml6 A G 11: 29,783,205 (GRCm39) Y559H probably damaging Het
Esp4 A G 17: 40,913,192 (GRCm39) T20A possibly damaging Het
Fbxw21 T C 9: 108,985,639 (GRCm39) probably null Het
Gcc2 T A 10: 58,114,574 (GRCm39) probably null Het
Grin3b C T 10: 79,811,559 (GRCm39) A715V possibly damaging Het
Gxylt2 A T 6: 100,764,170 (GRCm39) probably null Het
Hspa4 A T 11: 53,171,404 (GRCm39) S267T probably benign Het
Hspd1 A G 1: 55,117,785 (GRCm39) V491A possibly damaging Het
Idua A G 5: 108,828,486 (GRCm39) E280G probably benign Het
Ift172 T A 5: 31,417,988 (GRCm39) E1267V probably benign Het
Itsn1 T A 16: 91,702,182 (GRCm39) V1448E unknown Het
Kat6a A G 8: 23,416,432 (GRCm39) M647V possibly damaging Het
Kcnq4 A T 4: 120,568,494 (GRCm39) D407E probably benign Het
Kif1b A T 4: 149,354,378 (GRCm39) F221I probably damaging Het
Lama2 G T 10: 27,239,609 (GRCm39) D315E probably damaging Het
Lrrn4 G A 2: 132,720,096 (GRCm39) L235F probably damaging Het
Map2k6 T A 11: 110,390,210 (GRCm39) I248N Het
Mia2 A G 12: 59,155,651 (GRCm39) K455E probably damaging Het
Mrs2 A G 13: 25,204,221 (GRCm39) C3R possibly damaging Het
Nprl3 A G 11: 32,187,357 (GRCm39) I325T probably damaging Het
Nr1h3 T A 2: 91,021,229 (GRCm39) Q186L probably benign Het
Oas1f A G 5: 120,989,538 (GRCm39) E159G probably benign Het
Or2g7 A T 17: 38,378,412 (GRCm39) M117L possibly damaging Het
Or4k15b T A 14: 50,272,252 (GRCm39) S203C probably damaging Het
Or52ae7 T A 7: 103,119,504 (GRCm39) F86Y probably damaging Het
Or52e19b T A 7: 103,032,970 (GRCm39) I80F probably damaging Het
Or52s1b T A 7: 102,822,242 (GRCm39) S201C probably damaging Het
Or5m12 A G 2: 85,734,942 (GRCm39) F152S probably benign Het
Or8g4 T C 9: 39,662,417 (GRCm39) I245T probably damaging Het
Or9a4 T A 6: 40,549,154 (GRCm39) I278N probably benign Het
Pbxip1 G C 3: 89,353,648 (GRCm39) S267T probably benign Het
Pcdhga10 A T 18: 37,881,645 (GRCm39) I469F possibly damaging Het
Pkd1l1 A G 11: 8,804,375 (GRCm39) S1739P probably damaging Het
Plcd4 A C 1: 74,604,464 (GRCm39) N788T probably benign Het
Pms2 T A 5: 143,867,909 (GRCm39) W838R probably damaging Het
Pnpla6 T A 8: 3,586,562 (GRCm39) V926D probably damaging Het
Pros1 A T 16: 62,748,516 (GRCm39) H663L possibly damaging Het
Prss55 T C 14: 64,316,138 (GRCm39) probably null Het
Pum2 T C 12: 8,763,904 (GRCm39) Y283H probably damaging Het
Rad21 A G 15: 51,828,422 (GRCm39) S549P probably benign Het
Sap130 T A 18: 31,781,182 (GRCm39) probably null Het
Sertad4 C T 1: 192,529,189 (GRCm39) S209N probably benign Het
Sez6 A G 11: 77,844,668 (GRCm39) T164A probably benign Het
Slc22a28 C T 19: 8,078,837 (GRCm39) R284Q probably damaging Het
Slco4c1 T C 1: 96,764,650 (GRCm39) K474R probably benign Het
Stx5a T C 19: 8,719,802 (GRCm39) S56P probably damaging Het
Svopl T C 6: 37,991,744 (GRCm39) T379A probably damaging Het
Sypl2 A G 3: 108,125,008 (GRCm39) F118L probably damaging Het
Tfrc G A 16: 32,435,967 (GRCm39) V215M probably benign Het
Thnsl2 T C 6: 71,115,652 (GRCm39) N185S probably damaging Het
Tmem104 T C 11: 115,134,580 (GRCm39) I372T probably damaging Het
Tnfaip6 G A 2: 51,941,070 (GRCm39) G204S probably damaging Het
Trim12a C T 7: 103,953,335 (GRCm39) E259K probably benign Het
Tubgcp6 G A 15: 88,986,232 (GRCm39) R1436C probably benign Het
Tyrp1 C T 4: 80,758,864 (GRCm39) L246F probably damaging Het
Ubr4 G T 4: 139,145,717 (GRCm39) V216F Het
Unc5a A G 13: 55,147,319 (GRCm39) I409V possibly damaging Het
Vmn1r15 T C 6: 57,235,399 (GRCm39) L89P probably damaging Het
Vmn1r32 A T 6: 66,530,305 (GRCm39) L157* probably null Het
Zcchc24 A G 14: 25,720,185 (GRCm39) Y160H probably damaging Het
Zfp184 A T 13: 22,144,376 (GRCm39) H694L probably damaging Het
Zfp345 A C 2: 150,314,723 (GRCm39) Y271* probably null Het
Zranb3 T C 1: 128,030,671 (GRCm39) probably benign Het
Other mutations in Mgat5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00479:Mgat5 APN 1 127,315,204 (GRCm39) missense probably damaging 1.00
IGL00813:Mgat5 APN 1 127,312,543 (GRCm39) missense probably benign
IGL01795:Mgat5 APN 1 127,396,968 (GRCm39) missense probably damaging 0.98
IGL01830:Mgat5 APN 1 127,339,869 (GRCm39) missense probably damaging 1.00
IGL01879:Mgat5 APN 1 127,325,287 (GRCm39) missense probably damaging 0.99
IGL02322:Mgat5 APN 1 127,310,722 (GRCm39) missense probably benign 0.00
IGL02621:Mgat5 APN 1 127,325,326 (GRCm39) missense possibly damaging 0.86
IGL02695:Mgat5 APN 1 127,339,868 (GRCm39) missense probably damaging 1.00
IGL03142:Mgat5 APN 1 127,339,960 (GRCm39) missense probably damaging 1.00
Cowlick UTSW 1 127,399,301 (GRCm39) missense probably benign 0.36
Curls UTSW 1 127,248,371 (GRCm39) missense possibly damaging 0.77
R0518:Mgat5 UTSW 1 127,312,584 (GRCm39) missense probably damaging 1.00
R0594:Mgat5 UTSW 1 127,339,985 (GRCm39) missense probably damaging 0.96
R1480:Mgat5 UTSW 1 127,387,716 (GRCm39) missense probably damaging 1.00
R1501:Mgat5 UTSW 1 127,325,378 (GRCm39) critical splice donor site probably null
R1712:Mgat5 UTSW 1 127,248,375 (GRCm39) missense probably benign 0.34
R1744:Mgat5 UTSW 1 127,407,206 (GRCm39) missense probably damaging 1.00
R1862:Mgat5 UTSW 1 127,387,706 (GRCm39) missense probably damaging 1.00
R1994:Mgat5 UTSW 1 127,387,696 (GRCm39) missense possibly damaging 0.82
R2054:Mgat5 UTSW 1 127,325,344 (GRCm39) missense probably damaging 1.00
R2150:Mgat5 UTSW 1 127,396,987 (GRCm39) missense probably damaging 1.00
R2303:Mgat5 UTSW 1 127,374,036 (GRCm39) missense probably benign 0.00
R2566:Mgat5 UTSW 1 127,234,741 (GRCm39) missense probably benign 0.01
R3498:Mgat5 UTSW 1 127,312,571 (GRCm39) missense possibly damaging 0.55
R3788:Mgat5 UTSW 1 127,294,180 (GRCm39) missense probably benign
R4674:Mgat5 UTSW 1 127,318,495 (GRCm39) missense probably damaging 1.00
R4873:Mgat5 UTSW 1 127,396,986 (GRCm39) missense probably damaging 1.00
R4875:Mgat5 UTSW 1 127,396,986 (GRCm39) missense probably damaging 1.00
R5175:Mgat5 UTSW 1 127,387,649 (GRCm39) missense probably damaging 0.97
R5310:Mgat5 UTSW 1 127,315,251 (GRCm39) critical splice donor site probably null
R5337:Mgat5 UTSW 1 127,387,658 (GRCm39) missense possibly damaging 0.84
R5597:Mgat5 UTSW 1 127,325,303 (GRCm39) missense probably damaging 1.00
R5599:Mgat5 UTSW 1 127,325,303 (GRCm39) missense probably damaging 1.00
R5861:Mgat5 UTSW 1 127,315,129 (GRCm39) missense probably damaging 1.00
R5956:Mgat5 UTSW 1 127,310,676 (GRCm39) missense probably benign 0.10
R6042:Mgat5 UTSW 1 127,387,636 (GRCm39) missense probably damaging 1.00
R6223:Mgat5 UTSW 1 127,310,716 (GRCm39) missense possibly damaging 0.86
R6492:Mgat5 UTSW 1 127,399,301 (GRCm39) missense probably benign 0.36
R6662:Mgat5 UTSW 1 127,396,974 (GRCm39) missense probably damaging 1.00
R6960:Mgat5 UTSW 1 127,248,371 (GRCm39) missense possibly damaging 0.77
R6981:Mgat5 UTSW 1 127,318,588 (GRCm39) missense probably damaging 0.98
R7110:Mgat5 UTSW 1 127,310,716 (GRCm39) missense possibly damaging 0.92
R7133:Mgat5 UTSW 1 127,292,926 (GRCm39) missense probably benign
R7142:Mgat5 UTSW 1 127,339,924 (GRCm39) missense probably damaging 1.00
R7151:Mgat5 UTSW 1 127,373,999 (GRCm39) missense probably damaging 0.97
R7506:Mgat5 UTSW 1 127,294,192 (GRCm39) missense probably benign 0.24
R7790:Mgat5 UTSW 1 127,339,941 (GRCm39) missense probably benign 0.23
R8548:Mgat5 UTSW 1 127,248,409 (GRCm39) missense possibly damaging 0.77
R9008:Mgat5 UTSW 1 127,407,308 (GRCm39) missense probably damaging 1.00
R9127:Mgat5 UTSW 1 127,294,197 (GRCm39) missense probably benign 0.14
R9279:Mgat5 UTSW 1 127,325,348 (GRCm39) missense probably damaging 1.00
R9599:Mgat5 UTSW 1 127,248,445 (GRCm39) missense probably benign 0.02
X0028:Mgat5 UTSW 1 127,294,222 (GRCm39) missense possibly damaging 0.91
Z1177:Mgat5 UTSW 1 127,410,429 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTTAGAGAGGTCACAGCCTGTC -3'
(R):5'- TGAGTGCCTTTCAACCCTTG -3'

Sequencing Primer
(F):5'- CTGTCCCAGGCATGTGC -3'
(R):5'- TTGTCTAAGGCAGGCCACAG -3'
Posted On 2020-09-15