Incidental Mutation 'R7980:Chil4'
ID 651123
Institutional Source Beutler Lab
Gene Symbol Chil4
Ensembl Gene ENSMUSG00000063779
Gene Name chitinase-like 4
Synonyms Chi3l4, Ym2
MMRRC Submission 046021-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7980 (G1)
Quality Score 146.008
Status Validated
Chromosome 3
Chromosomal Location 106108807-106126795 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 106110060 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Lysine to Glutamic Acid at position 345 (K345E)
Ref Sequence ENSEMBL: ENSMUSP00000080851 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082219]
AlphaFold Q91Z98
Predicted Effect probably damaging
Transcript: ENSMUST00000082219
AA Change: K345E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000080851
Gene: ENSMUSG00000063779
AA Change: K345E

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Glyco_18 22 365 1.77e-132 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (87/87)
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930553M12Rik A G 4: 88,786,315 (GRCm39) L101P unknown Het
Actn3 G A 19: 4,917,950 (GRCm39) P339L probably damaging Het
Adamts12 G A 15: 11,263,423 (GRCm39) C595Y probably damaging Het
Adrm1b T A 3: 92,336,406 (GRCm39) K99* probably null Het
Agl A T 3: 116,585,830 (GRCm39) N99K probably benign Het
Aplp1 A T 7: 30,134,992 (GRCm39) M592K probably benign Het
Arhgef11 C T 3: 87,605,297 (GRCm39) R251C probably benign Het
Arhgef12 A T 9: 42,882,595 (GRCm39) C1416* probably null Het
Asah1 A G 8: 41,807,067 (GRCm39) M119T Het
Asxl2 A T 12: 3,546,630 (GRCm39) Q471H probably damaging Het
Atp6v1c2 A T 12: 17,371,613 (GRCm39) D61E probably damaging Het
Btbd16 C A 7: 130,426,097 (GRCm39) P520Q probably damaging Het
Cacnb2 A G 2: 14,609,326 (GRCm39) E22G probably benign Het
Catspere2 G T 1: 177,830,610 (GRCm39) probably null Het
Cdc25a T A 9: 109,708,949 (GRCm39) D124E probably damaging Het
Cdc42se1 A T 3: 95,139,166 (GRCm39) probably benign Het
Cdcp3 T A 7: 130,836,506 (GRCm39) V400E probably damaging Het
Cfap54 T C 10: 92,817,922 (GRCm39) K1265E possibly damaging Het
Chaf1b A G 16: 93,681,415 (GRCm39) H11R probably damaging Het
Cntnap1 A G 11: 101,079,719 (GRCm39) I1283V probably benign Het
Dagla C T 19: 10,229,406 (GRCm39) C618Y possibly damaging Het
Ddx19b C T 8: 111,738,077 (GRCm39) V224M possibly damaging Het
Dohh C T 10: 81,223,726 (GRCm39) R260* probably null Het
Dsg3 A T 18: 20,664,417 (GRCm39) N472Y probably benign Het
Duox1 T A 2: 122,177,801 (GRCm39) N1528K possibly damaging Het
Eml6 A G 11: 29,783,205 (GRCm39) Y559H probably damaging Het
Esp4 A G 17: 40,913,192 (GRCm39) T20A possibly damaging Het
Fbxw21 T C 9: 108,985,639 (GRCm39) probably null Het
Gcc2 T A 10: 58,114,574 (GRCm39) probably null Het
Grin3b C T 10: 79,811,559 (GRCm39) A715V possibly damaging Het
Gxylt2 A T 6: 100,764,170 (GRCm39) probably null Het
Hspa4 A T 11: 53,171,404 (GRCm39) S267T probably benign Het
Hspd1 A G 1: 55,117,785 (GRCm39) V491A possibly damaging Het
Idua A G 5: 108,828,486 (GRCm39) E280G probably benign Het
Ift172 T A 5: 31,417,988 (GRCm39) E1267V probably benign Het
Itsn1 T A 16: 91,702,182 (GRCm39) V1448E unknown Het
Kat6a A G 8: 23,416,432 (GRCm39) M647V possibly damaging Het
Kcnq4 A T 4: 120,568,494 (GRCm39) D407E probably benign Het
Kif1b A T 4: 149,354,378 (GRCm39) F221I probably damaging Het
Lama2 G T 10: 27,239,609 (GRCm39) D315E probably damaging Het
Lrrn4 G A 2: 132,720,096 (GRCm39) L235F probably damaging Het
Map2k6 T A 11: 110,390,210 (GRCm39) I248N Het
Mgat5 A G 1: 127,407,248 (GRCm39) Q638R probably benign Het
Mia2 A G 12: 59,155,651 (GRCm39) K455E probably damaging Het
Mrs2 A G 13: 25,204,221 (GRCm39) C3R possibly damaging Het
Nprl3 A G 11: 32,187,357 (GRCm39) I325T probably damaging Het
Nr1h3 T A 2: 91,021,229 (GRCm39) Q186L probably benign Het
Oas1f A G 5: 120,989,538 (GRCm39) E159G probably benign Het
Or2g7 A T 17: 38,378,412 (GRCm39) M117L possibly damaging Het
Or4k15b T A 14: 50,272,252 (GRCm39) S203C probably damaging Het
Or52ae7 T A 7: 103,119,504 (GRCm39) F86Y probably damaging Het
Or52e19b T A 7: 103,032,970 (GRCm39) I80F probably damaging Het
Or52s1b T A 7: 102,822,242 (GRCm39) S201C probably damaging Het
Or5m12 A G 2: 85,734,942 (GRCm39) F152S probably benign Het
Or8g4 T C 9: 39,662,417 (GRCm39) I245T probably damaging Het
Or9a4 T A 6: 40,549,154 (GRCm39) I278N probably benign Het
Pbxip1 G C 3: 89,353,648 (GRCm39) S267T probably benign Het
Pcdhga10 A T 18: 37,881,645 (GRCm39) I469F possibly damaging Het
Pkd1l1 A G 11: 8,804,375 (GRCm39) S1739P probably damaging Het
Plcd4 A C 1: 74,604,464 (GRCm39) N788T probably benign Het
Pms2 T A 5: 143,867,909 (GRCm39) W838R probably damaging Het
Pnpla6 T A 8: 3,586,562 (GRCm39) V926D probably damaging Het
Pros1 A T 16: 62,748,516 (GRCm39) H663L possibly damaging Het
Prss55 T C 14: 64,316,138 (GRCm39) probably null Het
Pum2 T C 12: 8,763,904 (GRCm39) Y283H probably damaging Het
Rad21 A G 15: 51,828,422 (GRCm39) S549P probably benign Het
Sap130 T A 18: 31,781,182 (GRCm39) probably null Het
Sertad4 C T 1: 192,529,189 (GRCm39) S209N probably benign Het
Sez6 A G 11: 77,844,668 (GRCm39) T164A probably benign Het
Slc22a28 C T 19: 8,078,837 (GRCm39) R284Q probably damaging Het
Slco4c1 T C 1: 96,764,650 (GRCm39) K474R probably benign Het
Stx5a T C 19: 8,719,802 (GRCm39) S56P probably damaging Het
Svopl T C 6: 37,991,744 (GRCm39) T379A probably damaging Het
Sypl2 A G 3: 108,125,008 (GRCm39) F118L probably damaging Het
Tfrc G A 16: 32,435,967 (GRCm39) V215M probably benign Het
Thnsl2 T C 6: 71,115,652 (GRCm39) N185S probably damaging Het
Tmem104 T C 11: 115,134,580 (GRCm39) I372T probably damaging Het
Tnfaip6 G A 2: 51,941,070 (GRCm39) G204S probably damaging Het
Trim12a C T 7: 103,953,335 (GRCm39) E259K probably benign Het
Tubgcp6 G A 15: 88,986,232 (GRCm39) R1436C probably benign Het
Tyrp1 C T 4: 80,758,864 (GRCm39) L246F probably damaging Het
Ubr4 G T 4: 139,145,717 (GRCm39) V216F Het
Unc5a A G 13: 55,147,319 (GRCm39) I409V possibly damaging Het
Vmn1r15 T C 6: 57,235,399 (GRCm39) L89P probably damaging Het
Vmn1r32 A T 6: 66,530,305 (GRCm39) L157* probably null Het
Zcchc24 A G 14: 25,720,185 (GRCm39) Y160H probably damaging Het
Zfp184 A T 13: 22,144,376 (GRCm39) H694L probably damaging Het
Zfp345 A C 2: 150,314,723 (GRCm39) Y271* probably null Het
Zranb3 T C 1: 128,030,671 (GRCm39) probably benign Het
Other mutations in Chil4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00778:Chil4 APN 3 106,109,113 (GRCm39) missense probably benign
IGL02457:Chil4 APN 3 106,121,715 (GRCm39) missense probably benign
R1087:Chil4 UTSW 3 106,117,881 (GRCm39) missense probably benign 0.01
R1398:Chil4 UTSW 3 106,126,825 (GRCm39) splice site probably null
R1503:Chil4 UTSW 3 106,113,350 (GRCm39) missense probably benign
R1553:Chil4 UTSW 3 106,111,006 (GRCm39) missense probably benign 0.02
R1806:Chil4 UTSW 3 106,117,959 (GRCm39) splice site probably benign
R1873:Chil4 UTSW 3 106,113,414 (GRCm39) missense probably benign 0.00
R2069:Chil4 UTSW 3 106,126,771 (GRCm39) missense probably benign 0.16
R2100:Chil4 UTSW 3 106,121,663 (GRCm39) missense probably benign
R2370:Chil4 UTSW 3 106,121,616 (GRCm39) nonsense probably null
R2984:Chil4 UTSW 3 106,111,043 (GRCm39) missense possibly damaging 0.95
R2985:Chil4 UTSW 3 106,111,043 (GRCm39) missense possibly damaging 0.95
R3522:Chil4 UTSW 3 106,111,056 (GRCm39) missense probably benign 0.08
R3919:Chil4 UTSW 3 106,109,848 (GRCm39) missense probably benign 0.00
R4033:Chil4 UTSW 3 106,121,765 (GRCm39) missense probably damaging 1.00
R4181:Chil4 UTSW 3 106,111,043 (GRCm39) missense possibly damaging 0.95
R4184:Chil4 UTSW 3 106,111,043 (GRCm39) missense possibly damaging 0.95
R4301:Chil4 UTSW 3 106,111,043 (GRCm39) missense possibly damaging 0.95
R4347:Chil4 UTSW 3 106,110,144 (GRCm39) missense probably benign
R4391:Chil4 UTSW 3 106,111,043 (GRCm39) missense possibly damaging 0.95
R4395:Chil4 UTSW 3 106,111,043 (GRCm39) missense possibly damaging 0.95
R4418:Chil4 UTSW 3 106,111,043 (GRCm39) missense possibly damaging 0.95
R4483:Chil4 UTSW 3 106,121,678 (GRCm39) missense probably damaging 1.00
R4544:Chil4 UTSW 3 106,117,922 (GRCm39) missense probably damaging 0.97
R4887:Chil4 UTSW 3 106,111,460 (GRCm39) missense probably benign 0.01
R4949:Chil4 UTSW 3 106,113,408 (GRCm39) missense possibly damaging 0.83
R5076:Chil4 UTSW 3 106,109,913 (GRCm39) missense probably damaging 1.00
R5146:Chil4 UTSW 3 106,110,150 (GRCm39) missense probably benign 0.18
R5254:Chil4 UTSW 3 106,126,768 (GRCm39) missense probably benign 0.00
R5521:Chil4 UTSW 3 106,111,013 (GRCm39) missense possibly damaging 0.50
R5790:Chil4 UTSW 3 106,109,894 (GRCm39) missense probably benign 0.00
R5883:Chil4 UTSW 3 106,117,886 (GRCm39) missense possibly damaging 0.48
R6010:Chil4 UTSW 3 106,121,711 (GRCm39) missense probably damaging 1.00
R6257:Chil4 UTSW 3 106,111,412 (GRCm39) missense possibly damaging 0.84
R6269:Chil4 UTSW 3 106,111,487 (GRCm39) missense probably damaging 1.00
R6602:Chil4 UTSW 3 106,117,906 (GRCm39) missense probably benign 0.00
R7113:Chil4 UTSW 3 106,121,664 (GRCm39) missense probably benign
R7113:Chil4 UTSW 3 106,110,083 (GRCm39) missense probably damaging 1.00
R7188:Chil4 UTSW 3 106,111,475 (GRCm39) missense probably damaging 1.00
R8810:Chil4 UTSW 3 106,109,121 (GRCm39) missense probably damaging 0.99
R9300:Chil4 UTSW 3 106,109,874 (GRCm39) missense probably benign 0.10
R9307:Chil4 UTSW 3 106,111,382 (GRCm39) critical splice donor site probably null
R9529:Chil4 UTSW 3 106,118,656 (GRCm39) missense probably damaging 1.00
X0067:Chil4 UTSW 3 106,113,350 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GTAGTTGTCAGAGGGAAACGTCC -3'
(R):5'- CTGTAGAACCAGGATTCAGGG -3'

Sequencing Primer
(F):5'- GGAAACGTCCCTGGTGAC -3'
(R):5'- TAGAACCAGGATTCAGGGAAATATC -3'
Posted On 2020-09-15