Incidental Mutation 'R7980:Idua'
ID651132
Institutional Source Beutler Lab
Gene Symbol Idua
Ensembl Gene ENSMUSG00000033540
Gene Nameiduronidase, alpha-L-
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.141) question?
Stock #R7980 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location108660331-108684557 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 108680620 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 280 (E280G)
Ref Sequence ENSEMBL: ENSMUSP00000071577 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071650] [ENSMUST00000112563] [ENSMUST00000119212] [ENSMUST00000139734] [ENSMUST00000140620]
Predicted Effect probably benign
Transcript: ENSMUST00000071650
AA Change: E280G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000071577
Gene: ENSMUSG00000033540
AA Change: E280G

DomainStartEndE-ValueType
Pfam:Glyco_hydro_39 22 542 1.4e-223 PFAM
SCOP:d1bpv__ 546 643 3e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112563
AA Change: E280G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000108182
Gene: ENSMUSG00000033540
AA Change: E280G

DomainStartEndE-ValueType
Pfam:Glyco_hydro_39 22 542 2.1e-224 PFAM
SCOP:d1bpv__ 546 643 3e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000119212
AA Change: E233G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000113190
Gene: ENSMUSG00000033540
AA Change: E233G

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Glyco_hydro_39 48 495 2.4e-193 PFAM
SCOP:d1bpv__ 499 596 3e-8 SMART
Predicted Effect unknown
Transcript: ENSMUST00000139734
AA Change: S247G
SMART Domains Protein: ENSMUSP00000117694
Gene: ENSMUSG00000033540
AA Change: S247G

DomainStartEndE-ValueType
Pfam:Glyco_hydro_39 22 199 6.8e-80 PFAM
low complexity region 235 260 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000140620
SMART Domains Protein: ENSMUSP00000119624
Gene: ENSMUSG00000033540

DomainStartEndE-ValueType
Pfam:Glyco_hydro_39 22 150 3.4e-52 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (87/87)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme that hydrolyzes the terminal alpha-L-iduronic acid residues of two glycosaminoglycans, dermatan sulfate and heparan sulfate. This hydrolysis is required for the lysosomal degradation of these glycosaminoglycans. Mutations in this gene that result in enzymatic deficiency lead to the autosomal recessive disease mucopolysaccharidosis type I (MPS I). [provided by RefSeq, Jul 2008]
PHENOTYPE: Targeted mutants show lysosomal storage in multiple tissues, increased urinary GAG, craniofacial and skeletal defects, increased body weight, impaired habituation and long-term memory for aversive training, reduced ventricular function with valve insufficiency, and progressive hearing loss. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930553M12Rik A G 4: 88,868,078 L101P unknown Het
5430419D17Rik T A 7: 131,234,777 V400E probably damaging Het
Actn3 G A 19: 4,867,922 P339L probably damaging Het
Adamts12 G A 15: 11,263,337 C595Y probably damaging Het
Agl A T 3: 116,792,181 N99K probably benign Het
Aplp1 A T 7: 30,435,567 M592K probably benign Het
Arhgef11 C T 3: 87,697,990 R251C probably benign Het
Arhgef12 A T 9: 42,971,299 C1416* probably null Het
Asah1 A G 8: 41,354,030 M119T Het
Asxl2 A T 12: 3,496,630 Q471H probably damaging Het
Atp6v1c2 A T 12: 17,321,612 D61E probably damaging Het
Btbd16 C A 7: 130,824,367 P520Q probably damaging Het
Cacnb2 A G 2: 14,604,515 E22G probably benign Het
Catspere2 G T 1: 178,003,044 probably null Het
Cdc25a T A 9: 109,879,881 D124E probably damaging Het
Cdc42se1 A T 3: 95,231,855 probably benign Het
Cfap54 T C 10: 92,982,060 K1265E possibly damaging Het
Chaf1b A G 16: 93,884,527 H11R probably damaging Het
Chil4 T C 3: 106,202,744 K345E probably damaging Het
Cntnap1 A G 11: 101,188,893 I1283V probably benign Het
Dagla C T 19: 10,252,042 C618Y possibly damaging Het
Ddx19b C T 8: 111,011,445 V224M possibly damaging Het
Dohh C T 10: 81,387,892 R260* probably null Het
Dsg3 A T 18: 20,531,360 N472Y probably benign Het
Duox1 T A 2: 122,347,320 N1528K possibly damaging Het
Eml6 A G 11: 29,833,205 Y559H probably damaging Het
Esp4 A G 17: 40,602,301 T20A possibly damaging Het
Fbxw21 T C 9: 109,156,571 probably null Het
Gcc2 T A 10: 58,278,752 probably null Het
Gm9774 T A 3: 92,429,099 K99* probably null Het
Grin3b C T 10: 79,975,725 A715V possibly damaging Het
Gxylt2 A T 6: 100,787,209 probably null Het
Hspa4 A T 11: 53,280,577 S267T probably benign Het
Hspd1 A G 1: 55,078,626 V491A possibly damaging Het
Ift172 T A 5: 31,260,644 E1267V probably benign Het
Itsn1 T A 16: 91,905,294 V1448E unknown Het
Kat6a A G 8: 22,926,416 M647V possibly damaging Het
Kcnq4 A T 4: 120,711,297 D407E probably benign Het
Kif1b A T 4: 149,269,921 F221I probably damaging Het
Lama2 G T 10: 27,363,613 D315E probably damaging Het
Lrrn4 G A 2: 132,878,176 L235F probably damaging Het
Map2k6 T A 11: 110,499,384 I248N Het
Mgat5 A G 1: 127,479,511 Q638R probably benign Het
Mia2 A G 12: 59,108,865 K455E probably damaging Het
Mrs2 A G 13: 25,020,238 C3R possibly damaging Het
Nprl3 A G 11: 32,237,357 I325T probably damaging Het
Nr1h3 T A 2: 91,190,884 Q186L probably benign Het
Oas1f A G 5: 120,851,475 E159G probably benign Het
Olfr1024 A G 2: 85,904,598 F152S probably benign Het
Olfr130 A T 17: 38,067,521 M117L possibly damaging Het
Olfr460 T A 6: 40,572,220 I278N probably benign Het
Olfr591 T A 7: 103,173,035 S201C probably damaging Het
Olfr603 T A 7: 103,383,763 I80F probably damaging Het
Olfr608 T A 7: 103,470,297 F86Y probably damaging Het
Olfr725 T A 14: 50,034,795 S203C probably damaging Het
Olfr967 T C 9: 39,751,121 I245T probably damaging Het
Pbxip1 G C 3: 89,446,341 S267T probably benign Het
Pcdhga10 A T 18: 37,748,592 I469F possibly damaging Het
Pkd1l1 A G 11: 8,854,375 S1739P probably damaging Het
Plcd4 A C 1: 74,565,305 N788T probably benign Het
Pms2 T A 5: 143,931,091 W838R probably damaging Het
Pnpla6 T A 8: 3,536,562 V926D probably damaging Het
Pros1 A T 16: 62,928,153 H663L possibly damaging Het
Prss55 T C 14: 64,078,689 probably null Het
Pum2 T C 12: 8,713,904 Y283H probably damaging Het
Rad21 A G 15: 51,965,026 S549P probably benign Het
Sap130 T A 18: 31,648,129 probably null Het
Sertad4 C T 1: 192,846,881 S209N probably benign Het
Sez6 A G 11: 77,953,842 T164A probably benign Het
Slc22a28 C T 19: 8,101,473 R284Q probably damaging Het
Slco4c1 T C 1: 96,836,925 K474R probably benign Het
Stx5a T C 19: 8,742,438 S56P probably damaging Het
Svopl T C 6: 38,014,809 T379A probably damaging Het
Sypl2 A G 3: 108,217,692 F118L probably damaging Het
Tfrc G A 16: 32,617,149 V215M probably benign Het
Thnsl2 T C 6: 71,138,668 N185S probably damaging Het
Tmem104 T C 11: 115,243,754 I372T probably damaging Het
Tnfaip6 G A 2: 52,051,058 G204S probably damaging Het
Trim12a C T 7: 104,304,128 E259K probably benign Het
Tubgcp6 G A 15: 89,102,029 R1436C probably benign Het
Tyrp1 C T 4: 80,840,627 L246F probably damaging Het
Ubr4 G T 4: 139,418,406 V216F Het
Unc5a A G 13: 54,999,506 I409V possibly damaging Het
Vmn1r15 T C 6: 57,258,414 L89P probably damaging Het
Vmn1r32 A T 6: 66,553,321 L157* probably null Het
Zcchc24 A G 14: 25,719,761 Y160H probably damaging Het
Zfp184 A T 13: 21,960,206 H694L probably damaging Het
Zfp345 A C 2: 150,472,803 Y271* probably null Het
Zranb3 T C 1: 128,102,934 probably benign Het
Other mutations in Idua
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01335:Idua APN 5 108680871 missense probably benign 0.34
IGL01575:Idua APN 5 108682107 missense possibly damaging 0.71
IGL02402:Idua APN 5 108679791 missense probably damaging 1.00
IGL03145:Idua APN 5 108681496 missense probably benign
Cooper UTSW 5 108680314 missense probably damaging 1.00
R0208:Idua UTSW 5 108681752 missense probably damaging 1.00
R1572:Idua UTSW 5 108680589 missense probably benign
R1731:Idua UTSW 5 108681672 missense probably benign 0.00
R2024:Idua UTSW 5 108680734 missense probably damaging 1.00
R2126:Idua UTSW 5 108681438 missense possibly damaging 0.93
R3760:Idua UTSW 5 108670112 unclassified probably benign
R4747:Idua UTSW 5 108681036 missense probably damaging 0.97
R4832:Idua UTSW 5 108669381 missense probably benign
R5140:Idua UTSW 5 108680314 missense probably damaging 1.00
R5543:Idua UTSW 5 108670229 missense probably benign 0.22
R5643:Idua UTSW 5 108680224 utr 3 prime probably benign
R5821:Idua UTSW 5 108679734 missense probably benign 0.29
R6004:Idua UTSW 5 108680644 missense probably benign
R6330:Idua UTSW 5 108681708 missense probably benign 0.21
R6963:Idua UTSW 5 108679775 missense possibly damaging 0.84
R7180:Idua UTSW 5 108680895 missense probably benign 0.43
R7453:Idua UTSW 5 108681496 missense probably benign
R7575:Idua UTSW 5 108681699 missense probably damaging 1.00
R7712:Idua UTSW 5 108681522 missense probably benign 0.10
R7923:Idua UTSW 5 108680583 missense probably damaging 1.00
R8026:Idua UTSW 5 108670249 missense probably benign 0.01
R8029:Idua UTSW 5 108669412 missense probably benign 0.23
R8074:Idua UTSW 5 108680575 missense possibly damaging 0.65
R8089:Idua UTSW 5 108681780 missense probably damaging 1.00
R8384:Idua UTSW 5 108681439 missense possibly damaging 0.70
Z1177:Idua UTSW 5 108679584 missense probably null 0.80
Z1177:Idua UTSW 5 108680623 frame shift probably null
Predicted Primers PCR Primer
(F):5'- ACCAACTTCTTCACTGGCGAG -3'
(R):5'- ACCTGTATCACTGGCCACTG -3'

Sequencing Primer
(F):5'- CTTCACTGGCGAGGTGGG -3'
(R):5'- GTATCACTGGCCACTGGTACTG -3'
Posted On2020-09-15