Incidental Mutation 'R7980:Arhgef12'
ID651153
Institutional Source Beutler Lab
Gene Symbol Arhgef12
Ensembl Gene ENSMUSG00000059495
Gene NameRho guanine nucleotide exchange factor (GEF) 12
SynonymsLARG, 2310014B11Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.952) question?
Stock #R7980 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location42963842-43107239 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 42971299 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 1416 (C1416*)
Ref Sequence ENSEMBL: ENSMUSP00000126598 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072767] [ENSMUST00000165665]
Predicted Effect probably null
Transcript: ENSMUST00000072767
AA Change: C1415*
SMART Domains Protein: ENSMUSP00000072547
Gene: ENSMUSG00000059495
AA Change: C1415*

DomainStartEndE-ValueType
low complexity region 49 64 N/A INTRINSIC
PDZ 80 148 1.64e-19 SMART
coiled coil region 196 259 N/A INTRINSIC
low complexity region 293 313 N/A INTRINSIC
Pfam:RGS-like 368 558 8.6e-87 PFAM
low complexity region 583 596 N/A INTRINSIC
low complexity region 663 676 N/A INTRINSIC
low complexity region 721 733 N/A INTRINSIC
RhoGEF 791 976 6.35e-66 SMART
PH 1020 1134 6.26e-6 SMART
low complexity region 1256 1269 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000165665
AA Change: C1416*
SMART Domains Protein: ENSMUSP00000126598
Gene: ENSMUSG00000059495
AA Change: C1416*

DomainStartEndE-ValueType
low complexity region 49 64 N/A INTRINSIC
PDZ 80 148 1.64e-19 SMART
coiled coil region 196 259 N/A INTRINSIC
low complexity region 293 313 N/A INTRINSIC
Pfam:RGS-like 369 559 1.6e-88 PFAM
low complexity region 584 597 N/A INTRINSIC
low complexity region 664 677 N/A INTRINSIC
low complexity region 722 734 N/A INTRINSIC
RhoGEF 792 977 6.35e-66 SMART
PH 1021 1135 6.26e-6 SMART
low complexity region 1257 1270 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (87/87)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Rho GTPases play a fundamental role in numerous cellular processes that are initiated by extracellular stimuli working through G protein-coupled receptors. The encoded protein may form a complex with G proteins and stimulate Rho-dependent signals. This protein has been observed to form a myeloid/lymphoid fusion partner in acute myeloid leukemia. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a null allele exhibit decreased sensitivity to certain vasoconstrictors and resistance to salt-induced hypertension. Mice homozygous for a different knock-out allele exhibit partial prenatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930553M12Rik A G 4: 88,868,078 L101P unknown Het
5430419D17Rik T A 7: 131,234,777 V400E probably damaging Het
Actn3 G A 19: 4,867,922 P339L probably damaging Het
Adamts12 G A 15: 11,263,337 C595Y probably damaging Het
Agl A T 3: 116,792,181 N99K probably benign Het
Aplp1 A T 7: 30,435,567 M592K probably benign Het
Arhgef11 C T 3: 87,697,990 R251C probably benign Het
Asah1 A G 8: 41,354,030 M119T Het
Asxl2 A T 12: 3,496,630 Q471H probably damaging Het
Atp6v1c2 A T 12: 17,321,612 D61E probably damaging Het
Btbd16 C A 7: 130,824,367 P520Q probably damaging Het
Cacnb2 A G 2: 14,604,515 E22G probably benign Het
Catspere2 G T 1: 178,003,044 probably null Het
Cdc25a T A 9: 109,879,881 D124E probably damaging Het
Cdc42se1 A T 3: 95,231,855 probably benign Het
Cfap54 T C 10: 92,982,060 K1265E possibly damaging Het
Chaf1b A G 16: 93,884,527 H11R probably damaging Het
Chil4 T C 3: 106,202,744 K345E probably damaging Het
Cntnap1 A G 11: 101,188,893 I1283V probably benign Het
Dagla C T 19: 10,252,042 C618Y possibly damaging Het
Ddx19b C T 8: 111,011,445 V224M possibly damaging Het
Dohh C T 10: 81,387,892 R260* probably null Het
Dsg3 A T 18: 20,531,360 N472Y probably benign Het
Duox1 T A 2: 122,347,320 N1528K possibly damaging Het
Eml6 A G 11: 29,833,205 Y559H probably damaging Het
Esp4 A G 17: 40,602,301 T20A possibly damaging Het
Fbxw21 T C 9: 109,156,571 probably null Het
Gcc2 T A 10: 58,278,752 probably null Het
Gm9774 T A 3: 92,429,099 K99* probably null Het
Grin3b C T 10: 79,975,725 A715V possibly damaging Het
Gxylt2 A T 6: 100,787,209 probably null Het
Hspa4 A T 11: 53,280,577 S267T probably benign Het
Hspd1 A G 1: 55,078,626 V491A possibly damaging Het
Idua A G 5: 108,680,620 E280G probably benign Het
Ift172 T A 5: 31,260,644 E1267V probably benign Het
Itsn1 T A 16: 91,905,294 V1448E unknown Het
Kat6a A G 8: 22,926,416 M647V possibly damaging Het
Kcnq4 A T 4: 120,711,297 D407E probably benign Het
Kif1b A T 4: 149,269,921 F221I probably damaging Het
Lama2 G T 10: 27,363,613 D315E probably damaging Het
Lrrn4 G A 2: 132,878,176 L235F probably damaging Het
Map2k6 T A 11: 110,499,384 I248N Het
Mgat5 A G 1: 127,479,511 Q638R probably benign Het
Mia2 A G 12: 59,108,865 K455E probably damaging Het
Mrs2 A G 13: 25,020,238 C3R possibly damaging Het
Nprl3 A G 11: 32,237,357 I325T probably damaging Het
Nr1h3 T A 2: 91,190,884 Q186L probably benign Het
Oas1f A G 5: 120,851,475 E159G probably benign Het
Olfr1024 A G 2: 85,904,598 F152S probably benign Het
Olfr130 A T 17: 38,067,521 M117L possibly damaging Het
Olfr460 T A 6: 40,572,220 I278N probably benign Het
Olfr591 T A 7: 103,173,035 S201C probably damaging Het
Olfr603 T A 7: 103,383,763 I80F probably damaging Het
Olfr608 T A 7: 103,470,297 F86Y probably damaging Het
Olfr725 T A 14: 50,034,795 S203C probably damaging Het
Olfr967 T C 9: 39,751,121 I245T probably damaging Het
Pbxip1 G C 3: 89,446,341 S267T probably benign Het
Pcdhga10 A T 18: 37,748,592 I469F possibly damaging Het
Pkd1l1 A G 11: 8,854,375 S1739P probably damaging Het
Plcd4 A C 1: 74,565,305 N788T probably benign Het
Pms2 T A 5: 143,931,091 W838R probably damaging Het
Pnpla6 T A 8: 3,536,562 V926D probably damaging Het
Pros1 A T 16: 62,928,153 H663L possibly damaging Het
Prss55 T C 14: 64,078,689 probably null Het
Pum2 T C 12: 8,713,904 Y283H probably damaging Het
Rad21 A G 15: 51,965,026 S549P probably benign Het
Sap130 T A 18: 31,648,129 probably null Het
Sertad4 C T 1: 192,846,881 S209N probably benign Het
Sez6 A G 11: 77,953,842 T164A probably benign Het
Slc22a28 C T 19: 8,101,473 R284Q probably damaging Het
Slco4c1 T C 1: 96,836,925 K474R probably benign Het
Stx5a T C 19: 8,742,438 S56P probably damaging Het
Svopl T C 6: 38,014,809 T379A probably damaging Het
Sypl2 A G 3: 108,217,692 F118L probably damaging Het
Tfrc G A 16: 32,617,149 V215M probably benign Het
Thnsl2 T C 6: 71,138,668 N185S probably damaging Het
Tmem104 T C 11: 115,243,754 I372T probably damaging Het
Tnfaip6 G A 2: 52,051,058 G204S probably damaging Het
Trim12a C T 7: 104,304,128 E259K probably benign Het
Tubgcp6 G A 15: 89,102,029 R1436C probably benign Het
Tyrp1 C T 4: 80,840,627 L246F probably damaging Het
Ubr4 G T 4: 139,418,406 V216F Het
Unc5a A G 13: 54,999,506 I409V possibly damaging Het
Vmn1r15 T C 6: 57,258,414 L89P probably damaging Het
Vmn1r32 A T 6: 66,553,321 L157* probably null Het
Zcchc24 A G 14: 25,719,761 Y160H probably damaging Het
Zfp184 A T 13: 21,960,206 H694L probably damaging Het
Zfp345 A C 2: 150,472,803 Y271* probably null Het
Zranb3 T C 1: 128,102,934 probably benign Het
Other mutations in Arhgef12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00923:Arhgef12 APN 9 43020624 missense probably damaging 1.00
IGL00942:Arhgef12 APN 9 42982000 missense probably damaging 1.00
IGL01529:Arhgef12 APN 9 42990055 missense probably damaging 1.00
IGL01845:Arhgef12 APN 9 43022841 missense possibly damaging 0.56
IGL02039:Arhgef12 APN 9 42972267 missense probably benign
IGL02135:Arhgef12 APN 9 42972165 missense possibly damaging 0.68
IGL02272:Arhgef12 APN 9 43001452 missense probably damaging 1.00
IGL02498:Arhgef12 APN 9 42982043 missense probably benign 0.19
IGL02507:Arhgef12 APN 9 42992563 missense probably damaging 1.00
IGL02574:Arhgef12 APN 9 43005623 missense probably damaging 0.99
IGL02586:Arhgef12 APN 9 43005904 nonsense probably null
IGL02803:Arhgef12 APN 9 42972028 missense possibly damaging 0.48
IGL02892:Arhgef12 APN 9 43000972 missense possibly damaging 0.79
IGL02937:Arhgef12 APN 9 43015920 missense probably damaging 0.97
IGL02992:Arhgef12 APN 9 42999077 missense probably damaging 1.00
IGL03028:Arhgef12 APN 9 43026228 missense possibly damaging 0.84
IGL03146:Arhgef12 APN 9 42974570 missense possibly damaging 0.90
IGL03193:Arhgef12 APN 9 42992533 splice site probably benign
IGL03398:Arhgef12 APN 9 42978226 missense probably damaging 1.00
R0019:Arhgef12 UTSW 9 42978233 missense probably damaging 1.00
R0143:Arhgef12 UTSW 9 43005594 missense probably damaging 1.00
R0211:Arhgef12 UTSW 9 42972004 missense probably damaging 0.97
R0330:Arhgef12 UTSW 9 43020686 missense probably damaging 0.97
R0364:Arhgef12 UTSW 9 43018401 missense probably damaging 0.99
R0426:Arhgef12 UTSW 9 42970990 splice site probably null
R0658:Arhgef12 UTSW 9 42981985 missense probably damaging 1.00
R0686:Arhgef12 UTSW 9 42993028 missense probably benign 0.02
R0693:Arhgef12 UTSW 9 43018401 missense probably damaging 0.99
R0990:Arhgef12 UTSW 9 42972381 missense probably benign 0.00
R1147:Arhgef12 UTSW 9 43044256 unclassified probably benign
R1395:Arhgef12 UTSW 9 43005870 missense probably damaging 1.00
R1419:Arhgef12 UTSW 9 43027220 missense probably damaging 1.00
R1451:Arhgef12 UTSW 9 42992578 splice site probably benign
R1458:Arhgef12 UTSW 9 42988998 missense probably damaging 0.98
R1654:Arhgef12 UTSW 9 42997660 missense possibly damaging 0.83
R1722:Arhgef12 UTSW 9 43020717 makesense probably null
R1773:Arhgef12 UTSW 9 43005542 critical splice donor site probably null
R1895:Arhgef12 UTSW 9 43005856 missense probably damaging 1.00
R2109:Arhgef12 UTSW 9 42979472 missense possibly damaging 0.75
R2215:Arhgef12 UTSW 9 43005871 missense probably damaging 1.00
R2421:Arhgef12 UTSW 9 43001006 missense probably damaging 1.00
R3967:Arhgef12 UTSW 9 43005551 missense probably damaging 1.00
R3968:Arhgef12 UTSW 9 43005551 missense probably damaging 1.00
R3969:Arhgef12 UTSW 9 43005551 missense probably damaging 1.00
R4077:Arhgef12 UTSW 9 42975292 missense probably damaging 0.99
R4079:Arhgef12 UTSW 9 42975292 missense probably damaging 0.99
R4111:Arhgef12 UTSW 9 42972274 missense probably damaging 1.00
R4302:Arhgef12 UTSW 9 43018349 nonsense probably null
R4327:Arhgef12 UTSW 9 42975229 nonsense probably null
R4462:Arhgef12 UTSW 9 42981982 missense probably damaging 1.00
R4583:Arhgef12 UTSW 9 42977662 missense probably damaging 1.00
R4603:Arhgef12 UTSW 9 43010193 missense probably benign 0.27
R4650:Arhgef12 UTSW 9 42981970 missense probably damaging 1.00
R4741:Arhgef12 UTSW 9 42972153 missense possibly damaging 0.54
R4823:Arhgef12 UTSW 9 43020696 missense probably benign
R4840:Arhgef12 UTSW 9 42975068 missense probably benign 0.04
R4912:Arhgef12 UTSW 9 42993065 nonsense probably null
R5176:Arhgef12 UTSW 9 43020686 missense probably damaging 0.97
R5426:Arhgef12 UTSW 9 42986584 missense probably damaging 1.00
R5579:Arhgef12 UTSW 9 43010193 missense probably benign 0.27
R5838:Arhgef12 UTSW 9 43005608 missense probably damaging 1.00
R6230:Arhgef12 UTSW 9 42988965 missense probably benign 0.04
R6741:Arhgef12 UTSW 9 42972207 missense probably benign 0.05
R6959:Arhgef12 UTSW 9 43015953 missense probably benign
R7252:Arhgef12 UTSW 9 43015909 missense probably benign 0.17
R7470:Arhgef12 UTSW 9 43040552 missense probably damaging 1.00
R7658:Arhgef12 UTSW 9 42992536 missense probably damaging 1.00
R7724:Arhgef12 UTSW 9 43027271 missense probably damaging 1.00
R8074:Arhgef12 UTSW 9 42971103 nonsense probably null
R8155:Arhgef12 UTSW 9 43042662 missense probably damaging 1.00
R8270:Arhgef12 UTSW 9 42971058 missense probably benign
R8407:Arhgef12 UTSW 9 43026179 critical splice donor site probably null
R8527:Arhgef12 UTSW 9 42997648 missense possibly damaging 0.95
RF020:Arhgef12 UTSW 9 42989989 missense possibly damaging 0.75
Z1176:Arhgef12 UTSW 9 42971072 missense probably benign 0.00
Z1186:Arhgef12 UTSW 9 43000015 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATTCTGGGGTGAATGGTGAAACC -3'
(R):5'- TGAGTGATACTCCGCTTGTCATG -3'

Sequencing Primer
(F):5'- TGAATGGTGAAACCGGCCC -3'
(R):5'- GATACTCCGCTTGTCATGTAAGGAC -3'
Posted On2020-09-15