Incidental Mutation 'R7980:Cdc25a'
ID651154
Institutional Source Beutler Lab
Gene Symbol Cdc25a
Ensembl Gene ENSMUSG00000032477
Gene Namecell division cycle 25A
SynonymsD9Ertd393e
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7980 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location109875579-109893895 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 109879881 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 124 (D124E)
Ref Sequence ENSEMBL: ENSMUSP00000091882 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094324] [ENSMUST00000198308] [ENSMUST00000198848]
Predicted Effect probably damaging
Transcript: ENSMUST00000094324
AA Change: D124E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000091882
Gene: ENSMUSG00000032477
AA Change: D124E

DomainStartEndE-ValueType
Pfam:M-inducer_phosp 85 318 3.6e-69 PFAM
RHOD 356 469 2.6e-25 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000198308
AA Change: D63E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000142958
Gene: ENSMUSG00000032477
AA Change: D63E

DomainStartEndE-ValueType
Pfam:M-inducer_phosp 24 258 1.2e-88 PFAM
RHOD 295 408 5.97e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000198848
Predicted Effect probably benign
Transcript: ENSMUST00000199787
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (87/87)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] CDC25A is a member of the CDC25 family of phosphatases. CDC25A is required for progression from G1 to the S phase of the cell cycle. It activates the cyclin-dependent kinase CDC2 by removing two phosphate groups. CDC25A is specifically degraded in response to DNA damage, which prevents cells with chromosomal abnormalities from progressing through cell division. CDC25A is an oncogene, although its exact role in oncogenesis has not been demonstrated. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a spontaneous mutation exhibit elevated levels of early erythroid progenitor cell cycling but erythropoiesis is normally unaffected. Homozygous deletion of this gene is lethal and male heterozygotes display decreased vertebral trabecular bone. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930553M12Rik A G 4: 88,868,078 L101P unknown Het
5430419D17Rik T A 7: 131,234,777 V400E probably damaging Het
Actn3 G A 19: 4,867,922 P339L probably damaging Het
Adamts12 G A 15: 11,263,337 C595Y probably damaging Het
Agl A T 3: 116,792,181 N99K probably benign Het
Aplp1 A T 7: 30,435,567 M592K probably benign Het
Arhgef11 C T 3: 87,697,990 R251C probably benign Het
Arhgef12 A T 9: 42,971,299 C1416* probably null Het
Asah1 A G 8: 41,354,030 M119T Het
Asxl2 A T 12: 3,496,630 Q471H probably damaging Het
Atp6v1c2 A T 12: 17,321,612 D61E probably damaging Het
Btbd16 C A 7: 130,824,367 P520Q probably damaging Het
Cacnb2 A G 2: 14,604,515 E22G probably benign Het
Catspere2 G T 1: 178,003,044 probably null Het
Cdc42se1 A T 3: 95,231,855 probably benign Het
Cfap54 T C 10: 92,982,060 K1265E possibly damaging Het
Chaf1b A G 16: 93,884,527 H11R probably damaging Het
Chil4 T C 3: 106,202,744 K345E probably damaging Het
Cntnap1 A G 11: 101,188,893 I1283V probably benign Het
Dagla C T 19: 10,252,042 C618Y possibly damaging Het
Ddx19b C T 8: 111,011,445 V224M possibly damaging Het
Dohh C T 10: 81,387,892 R260* probably null Het
Dsg3 A T 18: 20,531,360 N472Y probably benign Het
Duox1 T A 2: 122,347,320 N1528K possibly damaging Het
Eml6 A G 11: 29,833,205 Y559H probably damaging Het
Esp4 A G 17: 40,602,301 T20A possibly damaging Het
Fbxw21 T C 9: 109,156,571 probably null Het
Gcc2 T A 10: 58,278,752 probably null Het
Gm9774 T A 3: 92,429,099 K99* probably null Het
Grin3b C T 10: 79,975,725 A715V possibly damaging Het
Gxylt2 A T 6: 100,787,209 probably null Het
Hspa4 A T 11: 53,280,577 S267T probably benign Het
Hspd1 A G 1: 55,078,626 V491A possibly damaging Het
Idua A G 5: 108,680,620 E280G probably benign Het
Ift172 T A 5: 31,260,644 E1267V probably benign Het
Itsn1 T A 16: 91,905,294 V1448E unknown Het
Kat6a A G 8: 22,926,416 M647V possibly damaging Het
Kcnq4 A T 4: 120,711,297 D407E probably benign Het
Kif1b A T 4: 149,269,921 F221I probably damaging Het
Lama2 G T 10: 27,363,613 D315E probably damaging Het
Lrrn4 G A 2: 132,878,176 L235F probably damaging Het
Map2k6 T A 11: 110,499,384 I248N Het
Mgat5 A G 1: 127,479,511 Q638R probably benign Het
Mia2 A G 12: 59,108,865 K455E probably damaging Het
Mrs2 A G 13: 25,020,238 C3R possibly damaging Het
Nprl3 A G 11: 32,237,357 I325T probably damaging Het
Nr1h3 T A 2: 91,190,884 Q186L probably benign Het
Oas1f A G 5: 120,851,475 E159G probably benign Het
Olfr1024 A G 2: 85,904,598 F152S probably benign Het
Olfr130 A T 17: 38,067,521 M117L possibly damaging Het
Olfr460 T A 6: 40,572,220 I278N probably benign Het
Olfr591 T A 7: 103,173,035 S201C probably damaging Het
Olfr603 T A 7: 103,383,763 I80F probably damaging Het
Olfr608 T A 7: 103,470,297 F86Y probably damaging Het
Olfr725 T A 14: 50,034,795 S203C probably damaging Het
Olfr967 T C 9: 39,751,121 I245T probably damaging Het
Pbxip1 G C 3: 89,446,341 S267T probably benign Het
Pcdhga10 A T 18: 37,748,592 I469F possibly damaging Het
Pkd1l1 A G 11: 8,854,375 S1739P probably damaging Het
Plcd4 A C 1: 74,565,305 N788T probably benign Het
Pms2 T A 5: 143,931,091 W838R probably damaging Het
Pnpla6 T A 8: 3,536,562 V926D probably damaging Het
Pros1 A T 16: 62,928,153 H663L possibly damaging Het
Prss55 T C 14: 64,078,689 probably null Het
Pum2 T C 12: 8,713,904 Y283H probably damaging Het
Rad21 A G 15: 51,965,026 S549P probably benign Het
Sap130 T A 18: 31,648,129 probably null Het
Sertad4 C T 1: 192,846,881 S209N probably benign Het
Sez6 A G 11: 77,953,842 T164A probably benign Het
Slc22a28 C T 19: 8,101,473 R284Q probably damaging Het
Slco4c1 T C 1: 96,836,925 K474R probably benign Het
Stx5a T C 19: 8,742,438 S56P probably damaging Het
Svopl T C 6: 38,014,809 T379A probably damaging Het
Sypl2 A G 3: 108,217,692 F118L probably damaging Het
Tfrc G A 16: 32,617,149 V215M probably benign Het
Thnsl2 T C 6: 71,138,668 N185S probably damaging Het
Tmem104 T C 11: 115,243,754 I372T probably damaging Het
Tnfaip6 G A 2: 52,051,058 G204S probably damaging Het
Trim12a C T 7: 104,304,128 E259K probably benign Het
Tubgcp6 G A 15: 89,102,029 R1436C probably benign Het
Tyrp1 C T 4: 80,840,627 L246F probably damaging Het
Ubr4 G T 4: 139,418,406 V216F Het
Unc5a A G 13: 54,999,506 I409V possibly damaging Het
Vmn1r15 T C 6: 57,258,414 L89P probably damaging Het
Vmn1r32 A T 6: 66,553,321 L157* probably null Het
Zcchc24 A G 14: 25,719,761 Y160H probably damaging Het
Zfp184 A T 13: 21,960,206 H694L probably damaging Het
Zfp345 A C 2: 150,472,803 Y271* probably null Het
Zranb3 T C 1: 128,102,934 probably benign Het
Other mutations in Cdc25a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01658:Cdc25a APN 9 109876126 splice site probably null
IGL01761:Cdc25a APN 9 109891865 intron probably benign
IGL02808:Cdc25a APN 9 109883599 splice site probably null
IGL03241:Cdc25a APN 9 109884199 splice site probably null
P4748:Cdc25a UTSW 9 109884108 splice site probably benign
R1472:Cdc25a UTSW 9 109876089 missense probably benign 0.00
R1571:Cdc25a UTSW 9 109881546 missense possibly damaging 0.56
R1598:Cdc25a UTSW 9 109879893 frame shift probably null
R4135:Cdc25a UTSW 9 109881517 missense possibly damaging 0.62
R4301:Cdc25a UTSW 9 109889742 missense probably benign 0.23
R4386:Cdc25a UTSW 9 109889733 missense probably damaging 1.00
R5074:Cdc25a UTSW 9 109884140 missense possibly damaging 0.46
R5171:Cdc25a UTSW 9 109877161 missense probably benign 0.25
R5896:Cdc25a UTSW 9 109884365 missense probably benign 0.00
R5928:Cdc25a UTSW 9 109889793 missense probably damaging 1.00
R6223:Cdc25a UTSW 9 109889774 missense possibly damaging 0.85
R6240:Cdc25a UTSW 9 109884158 missense probably damaging 1.00
R6440:Cdc25a UTSW 9 109881498 missense probably benign
R6854:Cdc25a UTSW 9 109879927 missense probably damaging 1.00
R7219:Cdc25a UTSW 9 109889086 missense probably damaging 0.99
R8506:Cdc25a UTSW 9 109891752 missense probably damaging 0.99
R8790:Cdc25a UTSW 9 109887348 critical splice donor site probably null
R8807:Cdc25a UTSW 9 109879235 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GAGTTAGAGCAGGTTGAACCCC -3'
(R):5'- TGGCCTTTCCATTAGTCAGG -3'

Sequencing Primer
(F):5'- GGTGGTAAGCTAGTTTTTCCAAACCC -3'
(R):5'- CCATTAGTCAGGTTAGATGGCAGC -3'
Posted On2020-09-15