Incidental Mutation 'R7980:Grin3b'
ID651156
Institutional Source Beutler Lab
Gene Symbol Grin3b
Ensembl Gene ENSMUSG00000035745
Gene Nameglutamate receptor, ionotropic, NMDA3B
SynonymsNR3B
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7980 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location79970715-79977190 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 79975725 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 715 (A715V)
Ref Sequence ENSEMBL: ENSMUSP00000048576 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045085] [ENSMUST00000052885]
Predicted Effect possibly damaging
Transcript: ENSMUST00000045085
AA Change: A715V

PolyPhen 2 Score 0.753 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000048576
Gene: ENSMUSG00000035745
AA Change: A715V

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 39 60 N/A INTRINSIC
low complexity region 217 230 N/A INTRINSIC
PBPe 458 810 1.01e-82 SMART
Lig_chan-Glu_bd 459 522 6.6e-20 SMART
transmembrane domain 826 848 N/A INTRINSIC
low complexity region 914 930 N/A INTRINSIC
coiled coil region 950 984 N/A INTRINSIC
low complexity region 989 1001 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000052885
SMART Domains Protein: ENSMUSP00000056792
Gene: ENSMUSG00000013858

DomainStartEndE-ValueType
Pfam:Membralin 34 131 3.3e-44 PFAM
Pfam:Membralin 138 393 3.9e-130 PFAM
transmembrane domain 394 411 N/A INTRINSIC
low complexity region 455 470 N/A INTRINSIC
low complexity region 483 521 N/A INTRINSIC
low complexity region 531 544 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124536
SMART Domains Protein: ENSMUSP00000119572
Gene: ENSMUSG00000013858

DomainStartEndE-ValueType
Pfam:Membralin 4 101 1.6e-44 PFAM
Pfam:Membralin 108 297 7.7e-83 PFAM
Pfam:Membralin 316 387 5e-42 PFAM
transmembrane domain 388 405 N/A INTRINSIC
low complexity region 449 464 N/A INTRINSIC
low complexity region 477 515 N/A INTRINSIC
low complexity region 525 538 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000122984
Gene: ENSMUSG00000035745
AA Change: A132V

DomainStartEndE-ValueType
Pfam:Lig_chan 1 368 2.2e-20 PFAM
Predicted Effect
SMART Domains Protein: ENSMUSP00000116887
Gene: ENSMUSG00000035745
AA Change: A356V

DomainStartEndE-ValueType
PBPe 100 452 1.01e-82 SMART
Lig_chan-Glu_bd 101 164 6.6e-20 SMART
transmembrane domain 468 490 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (87/87)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a subunit of an N-methyl-D-aspartate (NMDA) receptor. The encoded protein is found primarily in motor neurons, where it forms a heterotetramer with GRIN1 to create an excitatory glycine receptor. Variations in this gene have been proposed to be linked to schizophrenia. [provided by RefSeq, Nov 2015]
PHENOTYPE: Mice homozygous for a null allele show a mild impairment in motor learning or coordination, reduced home cage activity, a highly increased social interaction with familiar cagemates in their home cage but moderately increased anxiety-like behavior and reduced social interaction in a new environment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930553M12Rik A G 4: 88,868,078 L101P unknown Het
5430419D17Rik T A 7: 131,234,777 V400E probably damaging Het
Actn3 G A 19: 4,867,922 P339L probably damaging Het
Adamts12 G A 15: 11,263,337 C595Y probably damaging Het
Agl A T 3: 116,792,181 N99K probably benign Het
Aplp1 A T 7: 30,435,567 M592K probably benign Het
Arhgef11 C T 3: 87,697,990 R251C probably benign Het
Arhgef12 A T 9: 42,971,299 C1416* probably null Het
Asah1 A G 8: 41,354,030 M119T Het
Asxl2 A T 12: 3,496,630 Q471H probably damaging Het
Atp6v1c2 A T 12: 17,321,612 D61E probably damaging Het
Btbd16 C A 7: 130,824,367 P520Q probably damaging Het
Cacnb2 A G 2: 14,604,515 E22G probably benign Het
Catspere2 G T 1: 178,003,044 probably null Het
Cdc25a T A 9: 109,879,881 D124E probably damaging Het
Cdc42se1 A T 3: 95,231,855 probably benign Het
Cfap54 T C 10: 92,982,060 K1265E possibly damaging Het
Chaf1b A G 16: 93,884,527 H11R probably damaging Het
Chil4 T C 3: 106,202,744 K345E probably damaging Het
Cntnap1 A G 11: 101,188,893 I1283V probably benign Het
Dagla C T 19: 10,252,042 C618Y possibly damaging Het
Ddx19b C T 8: 111,011,445 V224M possibly damaging Het
Dohh C T 10: 81,387,892 R260* probably null Het
Dsg3 A T 18: 20,531,360 N472Y probably benign Het
Duox1 T A 2: 122,347,320 N1528K possibly damaging Het
Eml6 A G 11: 29,833,205 Y559H probably damaging Het
Esp4 A G 17: 40,602,301 T20A possibly damaging Het
Fbxw21 T C 9: 109,156,571 probably null Het
Gcc2 T A 10: 58,278,752 probably null Het
Gm9774 T A 3: 92,429,099 K99* probably null Het
Gxylt2 A T 6: 100,787,209 probably null Het
Hspa4 A T 11: 53,280,577 S267T probably benign Het
Hspd1 A G 1: 55,078,626 V491A possibly damaging Het
Idua A G 5: 108,680,620 E280G probably benign Het
Ift172 T A 5: 31,260,644 E1267V probably benign Het
Itsn1 T A 16: 91,905,294 V1448E unknown Het
Kat6a A G 8: 22,926,416 M647V possibly damaging Het
Kcnq4 A T 4: 120,711,297 D407E probably benign Het
Kif1b A T 4: 149,269,921 F221I probably damaging Het
Lama2 G T 10: 27,363,613 D315E probably damaging Het
Lrrn4 G A 2: 132,878,176 L235F probably damaging Het
Map2k6 T A 11: 110,499,384 I248N Het
Mgat5 A G 1: 127,479,511 Q638R probably benign Het
Mia2 A G 12: 59,108,865 K455E probably damaging Het
Mrs2 A G 13: 25,020,238 C3R possibly damaging Het
Nprl3 A G 11: 32,237,357 I325T probably damaging Het
Nr1h3 T A 2: 91,190,884 Q186L probably benign Het
Oas1f A G 5: 120,851,475 E159G probably benign Het
Olfr1024 A G 2: 85,904,598 F152S probably benign Het
Olfr130 A T 17: 38,067,521 M117L possibly damaging Het
Olfr460 T A 6: 40,572,220 I278N probably benign Het
Olfr591 T A 7: 103,173,035 S201C probably damaging Het
Olfr603 T A 7: 103,383,763 I80F probably damaging Het
Olfr608 T A 7: 103,470,297 F86Y probably damaging Het
Olfr725 T A 14: 50,034,795 S203C probably damaging Het
Olfr967 T C 9: 39,751,121 I245T probably damaging Het
Pbxip1 G C 3: 89,446,341 S267T probably benign Het
Pcdhga10 A T 18: 37,748,592 I469F possibly damaging Het
Pkd1l1 A G 11: 8,854,375 S1739P probably damaging Het
Plcd4 A C 1: 74,565,305 N788T probably benign Het
Pms2 T A 5: 143,931,091 W838R probably damaging Het
Pnpla6 T A 8: 3,536,562 V926D probably damaging Het
Pros1 A T 16: 62,928,153 H663L possibly damaging Het
Prss55 T C 14: 64,078,689 probably null Het
Pum2 T C 12: 8,713,904 Y283H probably damaging Het
Rad21 A G 15: 51,965,026 S549P probably benign Het
Sap130 T A 18: 31,648,129 probably null Het
Sertad4 C T 1: 192,846,881 S209N probably benign Het
Sez6 A G 11: 77,953,842 T164A probably benign Het
Slc22a28 C T 19: 8,101,473 R284Q probably damaging Het
Slco4c1 T C 1: 96,836,925 K474R probably benign Het
Stx5a T C 19: 8,742,438 S56P probably damaging Het
Svopl T C 6: 38,014,809 T379A probably damaging Het
Sypl2 A G 3: 108,217,692 F118L probably damaging Het
Tfrc G A 16: 32,617,149 V215M probably benign Het
Thnsl2 T C 6: 71,138,668 N185S probably damaging Het
Tmem104 T C 11: 115,243,754 I372T probably damaging Het
Tnfaip6 G A 2: 52,051,058 G204S probably damaging Het
Trim12a C T 7: 104,304,128 E259K probably benign Het
Tubgcp6 G A 15: 89,102,029 R1436C probably benign Het
Tyrp1 C T 4: 80,840,627 L246F probably damaging Het
Ubr4 G T 4: 139,418,406 V216F Het
Unc5a A G 13: 54,999,506 I409V possibly damaging Het
Vmn1r15 T C 6: 57,258,414 L89P probably damaging Het
Vmn1r32 A T 6: 66,553,321 L157* probably null Het
Zcchc24 A G 14: 25,719,761 Y160H probably damaging Het
Zfp184 A T 13: 21,960,206 H694L probably damaging Het
Zfp345 A C 2: 150,472,803 Y271* probably null Het
Zranb3 T C 1: 128,102,934 probably benign Het
Other mutations in Grin3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02754:Grin3b APN 10 79972889 missense possibly damaging 0.50
IGL03352:Grin3b APN 10 79973781 missense probably damaging 0.99
R0485:Grin3b UTSW 10 79974056 missense possibly damaging 0.68
R0927:Grin3b UTSW 10 79971228 missense probably benign 0.04
R1526:Grin3b UTSW 10 79974602 missense probably damaging 1.00
R1699:Grin3b UTSW 10 79975882 missense probably damaging 0.99
R1789:Grin3b UTSW 10 79973408 missense probably benign
R1916:Grin3b UTSW 10 79974598 missense probably damaging 1.00
R1991:Grin3b UTSW 10 79970912 missense probably benign
R1991:Grin3b UTSW 10 79974646 missense probably damaging 1.00
R4359:Grin3b UTSW 10 79972897 missense probably benign 0.00
R4817:Grin3b UTSW 10 79976898 missense probably benign 0.01
R4909:Grin3b UTSW 10 79977104 makesense probably null
R4942:Grin3b UTSW 10 79975722 missense probably damaging 0.99
R4981:Grin3b UTSW 10 79976357 intron probably benign
R5689:Grin3b UTSW 10 79974631 missense probably damaging 1.00
R5910:Grin3b UTSW 10 79973021 missense probably benign 0.00
R6132:Grin3b UTSW 10 79976440 missense probably damaging 1.00
R6242:Grin3b UTSW 10 79976179 missense probably damaging 1.00
R6262:Grin3b UTSW 10 79974369 missense probably benign 0.38
R6336:Grin3b UTSW 10 79976461 missense probably damaging 1.00
R6942:Grin3b UTSW 10 79976119 critical splice donor site probably null
R7201:Grin3b UTSW 10 79974078 missense possibly damaging 0.96
R7322:Grin3b UTSW 10 79975695 missense probably damaging 1.00
R7526:Grin3b UTSW 10 79973051 missense probably benign
R7707:Grin3b UTSW 10 79975901 missense possibly damaging 0.89
R8069:Grin3b UTSW 10 79977034 missense unknown
R8128:Grin3b UTSW 10 79977110 missense
R8434:Grin3b UTSW 10 79974588 missense probably damaging 1.00
R8777:Grin3b UTSW 10 79973138 missense possibly damaging 0.96
R8777-TAIL:Grin3b UTSW 10 79973138 missense possibly damaging 0.96
R8848:Grin3b UTSW 10 79973833 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- TGCGGGTTACTGAATCTGAGC -3'
(R):5'- CATCTATGGACACCTCATAATCCAG -3'

Sequencing Primer
(F):5'- ACTGAATCTGAGCTCAGTGC -3'
(R):5'- TGGACACCTCATAATCCAGTAGTG -3'
Posted On2020-09-15