Incidental Mutation 'R7980:Dohh'
ID651157
Institutional Source Beutler Lab
Gene Symbol Dohh
Ensembl Gene ENSMUSG00000078440
Gene Namedeoxyhypusine hydroxylase/monooxygenase
Synonyms1110033C18Rik, Hlrc1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7980 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location81384428-81388352 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 81387892 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 260 (R260*)
Ref Sequence ENSEMBL: ENSMUSP00000072534 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072751] [ENSMUST00000121047] [ENSMUST00000125635] [ENSMUST00000134592] [ENSMUST00000142346] [ENSMUST00000144647] [ENSMUST00000156229]
Predicted Effect probably null
Transcript: ENSMUST00000072751
AA Change: R260*
SMART Domains Protein: ENSMUSP00000072534
Gene: ENSMUSG00000078440
AA Change: R260*

DomainStartEndE-ValueType
EZ_HEAT 21 50 2.06e0 SMART
EZ_HEAT 52 81 1.11e-5 SMART
EZ_HEAT 85 114 4.84e-6 SMART
EZ_HEAT 173 202 6.64e-4 SMART
EZ_HEAT 204 233 4.31e-3 SMART
EZ_HEAT 237 266 2e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000121047
SMART Domains Protein: ENSMUSP00000113112
Gene: ENSMUSG00000078440

DomainStartEndE-ValueType
EZ_HEAT 21 50 2.06e0 SMART
EZ_HEAT 52 81 1.11e-5 SMART
EZ_HEAT 85 114 4.84e-6 SMART
EZ_HEAT 173 202 4.18e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000125635
Predicted Effect probably null
Transcript: ENSMUST00000131968
AA Change: R117*
SMART Domains Protein: ENSMUSP00000115416
Gene: ENSMUSG00000113262
AA Change: R117*

DomainStartEndE-ValueType
EZ_HEAT 31 60 6.64e-4 SMART
EZ_HEAT 62 91 4.31e-3 SMART
EZ_HEAT 95 124 2e-7 SMART
transmembrane domain 171 193 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000134592
SMART Domains Protein: ENSMUSP00000120386
Gene: ENSMUSG00000078440

DomainStartEndE-ValueType
EZ_HEAT 21 50 2.06e0 SMART
EZ_HEAT 52 74 4.93e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000142346
SMART Domains Protein: ENSMUSP00000122952
Gene: ENSMUSG00000078440

DomainStartEndE-ValueType
EZ_HEAT 21 50 2.06e0 SMART
EZ_HEAT 52 81 1.11e-5 SMART
EZ_HEAT 85 114 4.84e-6 SMART
internal_repeat_1 156 188 1.17e-6 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000144647
SMART Domains Protein: ENSMUSP00000116074
Gene: ENSMUSG00000113262

DomainStartEndE-ValueType
EZ_HEAT 21 50 2.06e0 SMART
EZ_HEAT 52 81 1.11e-5 SMART
EZ_HEAT 85 114 4.84e-6 SMART
EZ_HEAT 173 199 1.34e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000156229
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (87/87)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a metalloenzyme that catalyzes the last step in the conversion of lysine to the unique amino acid hypusine in eukaryotic initiation factor 5A. The encoded protein hydroxylates deoxyhypusine to form hypusine in the mature eukaryotic initiation factor 5A protein. Alternative splicing results in multiple transcript variants.[provided by RefSeq, Feb 2009]
PHENOTYPE: Mice homozygous for a null mutation die prior to organogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930553M12Rik A G 4: 88,868,078 L101P unknown Het
5430419D17Rik T A 7: 131,234,777 V400E probably damaging Het
Actn3 G A 19: 4,867,922 P339L probably damaging Het
Adamts12 G A 15: 11,263,337 C595Y probably damaging Het
Agl A T 3: 116,792,181 N99K probably benign Het
Aplp1 A T 7: 30,435,567 M592K probably benign Het
Arhgef11 C T 3: 87,697,990 R251C probably benign Het
Arhgef12 A T 9: 42,971,299 C1416* probably null Het
Asah1 A G 8: 41,354,030 M119T Het
Asxl2 A T 12: 3,496,630 Q471H probably damaging Het
Atp6v1c2 A T 12: 17,321,612 D61E probably damaging Het
Btbd16 C A 7: 130,824,367 P520Q probably damaging Het
Cacnb2 A G 2: 14,604,515 E22G probably benign Het
Catspere2 G T 1: 178,003,044 probably null Het
Cdc25a T A 9: 109,879,881 D124E probably damaging Het
Cdc42se1 A T 3: 95,231,855 probably benign Het
Cfap54 T C 10: 92,982,060 K1265E possibly damaging Het
Chaf1b A G 16: 93,884,527 H11R probably damaging Het
Chil4 T C 3: 106,202,744 K345E probably damaging Het
Cntnap1 A G 11: 101,188,893 I1283V probably benign Het
Dagla C T 19: 10,252,042 C618Y possibly damaging Het
Ddx19b C T 8: 111,011,445 V224M possibly damaging Het
Dsg3 A T 18: 20,531,360 N472Y probably benign Het
Duox1 T A 2: 122,347,320 N1528K possibly damaging Het
Eml6 A G 11: 29,833,205 Y559H probably damaging Het
Esp4 A G 17: 40,602,301 T20A possibly damaging Het
Fbxw21 T C 9: 109,156,571 probably null Het
Gcc2 T A 10: 58,278,752 probably null Het
Gm9774 T A 3: 92,429,099 K99* probably null Het
Grin3b C T 10: 79,975,725 A715V possibly damaging Het
Gxylt2 A T 6: 100,787,209 probably null Het
Hspa4 A T 11: 53,280,577 S267T probably benign Het
Hspd1 A G 1: 55,078,626 V491A possibly damaging Het
Idua A G 5: 108,680,620 E280G probably benign Het
Ift172 T A 5: 31,260,644 E1267V probably benign Het
Itsn1 T A 16: 91,905,294 V1448E unknown Het
Kat6a A G 8: 22,926,416 M647V possibly damaging Het
Kcnq4 A T 4: 120,711,297 D407E probably benign Het
Kif1b A T 4: 149,269,921 F221I probably damaging Het
Lama2 G T 10: 27,363,613 D315E probably damaging Het
Lrrn4 G A 2: 132,878,176 L235F probably damaging Het
Map2k6 T A 11: 110,499,384 I248N Het
Mgat5 A G 1: 127,479,511 Q638R probably benign Het
Mia2 A G 12: 59,108,865 K455E probably damaging Het
Mrs2 A G 13: 25,020,238 C3R possibly damaging Het
Nprl3 A G 11: 32,237,357 I325T probably damaging Het
Nr1h3 T A 2: 91,190,884 Q186L probably benign Het
Oas1f A G 5: 120,851,475 E159G probably benign Het
Olfr1024 A G 2: 85,904,598 F152S probably benign Het
Olfr130 A T 17: 38,067,521 M117L possibly damaging Het
Olfr460 T A 6: 40,572,220 I278N probably benign Het
Olfr591 T A 7: 103,173,035 S201C probably damaging Het
Olfr603 T A 7: 103,383,763 I80F probably damaging Het
Olfr608 T A 7: 103,470,297 F86Y probably damaging Het
Olfr725 T A 14: 50,034,795 S203C probably damaging Het
Olfr967 T C 9: 39,751,121 I245T probably damaging Het
Pbxip1 G C 3: 89,446,341 S267T probably benign Het
Pcdhga10 A T 18: 37,748,592 I469F possibly damaging Het
Pkd1l1 A G 11: 8,854,375 S1739P probably damaging Het
Plcd4 A C 1: 74,565,305 N788T probably benign Het
Pms2 T A 5: 143,931,091 W838R probably damaging Het
Pnpla6 T A 8: 3,536,562 V926D probably damaging Het
Pros1 A T 16: 62,928,153 H663L possibly damaging Het
Prss55 T C 14: 64,078,689 probably null Het
Pum2 T C 12: 8,713,904 Y283H probably damaging Het
Rad21 A G 15: 51,965,026 S549P probably benign Het
Sap130 T A 18: 31,648,129 probably null Het
Sertad4 C T 1: 192,846,881 S209N probably benign Het
Sez6 A G 11: 77,953,842 T164A probably benign Het
Slc22a28 C T 19: 8,101,473 R284Q probably damaging Het
Slco4c1 T C 1: 96,836,925 K474R probably benign Het
Stx5a T C 19: 8,742,438 S56P probably damaging Het
Svopl T C 6: 38,014,809 T379A probably damaging Het
Sypl2 A G 3: 108,217,692 F118L probably damaging Het
Tfrc G A 16: 32,617,149 V215M probably benign Het
Thnsl2 T C 6: 71,138,668 N185S probably damaging Het
Tmem104 T C 11: 115,243,754 I372T probably damaging Het
Tnfaip6 G A 2: 52,051,058 G204S probably damaging Het
Trim12a C T 7: 104,304,128 E259K probably benign Het
Tubgcp6 G A 15: 89,102,029 R1436C probably benign Het
Tyrp1 C T 4: 80,840,627 L246F probably damaging Het
Ubr4 G T 4: 139,418,406 V216F Het
Unc5a A G 13: 54,999,506 I409V possibly damaging Het
Vmn1r15 T C 6: 57,258,414 L89P probably damaging Het
Vmn1r32 A T 6: 66,553,321 L157* probably null Het
Zcchc24 A G 14: 25,719,761 Y160H probably damaging Het
Zfp184 A T 13: 21,960,206 H694L probably damaging Het
Zfp345 A C 2: 150,472,803 Y271* probably null Het
Zranb3 T C 1: 128,102,934 probably benign Het
Other mutations in Dohh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00984:Dohh APN 10 81387922 splice site probably null
R0331:Dohh UTSW 10 81387812 missense probably benign 0.03
R5243:Dohh UTSW 10 81387369 missense probably benign 0.00
R7209:Dohh UTSW 10 81386040 missense probably damaging 1.00
R7687:Dohh UTSW 10 81387806 missense probably benign
R8271:Dohh UTSW 10 81386010 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTCCTTGGGACCCTATGTGC -3'
(R):5'- TGTGAGGCACAGCACACATG -3'

Sequencing Primer
(F):5'- GACCCTATGTGCCCACTG -3'
(R):5'- ACAGCACACATGGCCGG -3'
Posted On2020-09-15