Incidental Mutation 'R7980:Cfap54'
ID651158
Institutional Source Beutler Lab
Gene Symbol Cfap54
Ensembl Gene ENSMUSG00000020014
Gene Namecilia and flagella associated protein 54
SynonymsLOC380653, Gm872, 4930485B16Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.099) question?
Stock #R7980 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location92775619-93081618 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 92982060 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 1265 (K1265E)
Ref Sequence ENSEMBL: ENSMUSP00000148636 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168110] [ENSMUST00000170065] [ENSMUST00000212902]
Predicted Effect possibly damaging
Transcript: ENSMUST00000168110
AA Change: K1265E

PolyPhen 2 Score 0.528 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000129517
Gene: ENSMUSG00000020014
AA Change: K1265E

DomainStartEndE-ValueType
low complexity region 3 37 N/A INTRINSIC
low complexity region 39 48 N/A INTRINSIC
Pfam:DUF4486 104 642 1.1e-269 PFAM
low complexity region 842 851 N/A INTRINSIC
low complexity region 902 915 N/A INTRINSIC
Blast:FN3 916 1002 4e-48 BLAST
low complexity region 1409 1426 N/A INTRINSIC
low complexity region 1974 1984 N/A INTRINSIC
low complexity region 2354 2370 N/A INTRINSIC
low complexity region 2500 2513 N/A INTRINSIC
low complexity region 2605 2616 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000170065
Predicted Effect possibly damaging
Transcript: ENSMUST00000212902
AA Change: K1265E

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (87/87)
MGI Phenotype PHENOTYPE: Homozygous inactivation of this gene causes background-dependent lethality and hydroencephaly, male sterility associated with defects in spermiogenesis, and impaired mucociliary clearance. Airway epithelial cilia show structural defects and a decrease in ciliary beat frequency and cilia-driven flow. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930553M12Rik A G 4: 88,868,078 L101P unknown Het
5430419D17Rik T A 7: 131,234,777 V400E probably damaging Het
Actn3 G A 19: 4,867,922 P339L probably damaging Het
Adamts12 G A 15: 11,263,337 C595Y probably damaging Het
Agl A T 3: 116,792,181 N99K probably benign Het
Aplp1 A T 7: 30,435,567 M592K probably benign Het
Arhgef11 C T 3: 87,697,990 R251C probably benign Het
Arhgef12 A T 9: 42,971,299 C1416* probably null Het
Asah1 A G 8: 41,354,030 M119T Het
Asxl2 A T 12: 3,496,630 Q471H probably damaging Het
Atp6v1c2 A T 12: 17,321,612 D61E probably damaging Het
Btbd16 C A 7: 130,824,367 P520Q probably damaging Het
Cacnb2 A G 2: 14,604,515 E22G probably benign Het
Catspere2 G T 1: 178,003,044 probably null Het
Cdc25a T A 9: 109,879,881 D124E probably damaging Het
Cdc42se1 A T 3: 95,231,855 probably benign Het
Chaf1b A G 16: 93,884,527 H11R probably damaging Het
Chil4 T C 3: 106,202,744 K345E probably damaging Het
Cntnap1 A G 11: 101,188,893 I1283V probably benign Het
Dagla C T 19: 10,252,042 C618Y possibly damaging Het
Ddx19b C T 8: 111,011,445 V224M possibly damaging Het
Dohh C T 10: 81,387,892 R260* probably null Het
Dsg3 A T 18: 20,531,360 N472Y probably benign Het
Duox1 T A 2: 122,347,320 N1528K possibly damaging Het
Eml6 A G 11: 29,833,205 Y559H probably damaging Het
Esp4 A G 17: 40,602,301 T20A possibly damaging Het
Fbxw21 T C 9: 109,156,571 probably null Het
Gcc2 T A 10: 58,278,752 probably null Het
Gm9774 T A 3: 92,429,099 K99* probably null Het
Grin3b C T 10: 79,975,725 A715V possibly damaging Het
Gxylt2 A T 6: 100,787,209 probably null Het
Hspa4 A T 11: 53,280,577 S267T probably benign Het
Hspd1 A G 1: 55,078,626 V491A possibly damaging Het
Idua A G 5: 108,680,620 E280G probably benign Het
Ift172 T A 5: 31,260,644 E1267V probably benign Het
Itsn1 T A 16: 91,905,294 V1448E unknown Het
Kat6a A G 8: 22,926,416 M647V possibly damaging Het
Kcnq4 A T 4: 120,711,297 D407E probably benign Het
Kif1b A T 4: 149,269,921 F221I probably damaging Het
Lama2 G T 10: 27,363,613 D315E probably damaging Het
Lrrn4 G A 2: 132,878,176 L235F probably damaging Het
Map2k6 T A 11: 110,499,384 I248N Het
Mgat5 A G 1: 127,479,511 Q638R probably benign Het
Mia2 A G 12: 59,108,865 K455E probably damaging Het
Mrs2 A G 13: 25,020,238 C3R possibly damaging Het
Nprl3 A G 11: 32,237,357 I325T probably damaging Het
Nr1h3 T A 2: 91,190,884 Q186L probably benign Het
Oas1f A G 5: 120,851,475 E159G probably benign Het
Olfr1024 A G 2: 85,904,598 F152S probably benign Het
Olfr130 A T 17: 38,067,521 M117L possibly damaging Het
Olfr460 T A 6: 40,572,220 I278N probably benign Het
Olfr591 T A 7: 103,173,035 S201C probably damaging Het
Olfr603 T A 7: 103,383,763 I80F probably damaging Het
Olfr608 T A 7: 103,470,297 F86Y probably damaging Het
Olfr725 T A 14: 50,034,795 S203C probably damaging Het
Olfr967 T C 9: 39,751,121 I245T probably damaging Het
Pbxip1 G C 3: 89,446,341 S267T probably benign Het
Pcdhga10 A T 18: 37,748,592 I469F possibly damaging Het
Pkd1l1 A G 11: 8,854,375 S1739P probably damaging Het
Plcd4 A C 1: 74,565,305 N788T probably benign Het
Pms2 T A 5: 143,931,091 W838R probably damaging Het
Pnpla6 T A 8: 3,536,562 V926D probably damaging Het
Pros1 A T 16: 62,928,153 H663L possibly damaging Het
Prss55 T C 14: 64,078,689 probably null Het
Pum2 T C 12: 8,713,904 Y283H probably damaging Het
Rad21 A G 15: 51,965,026 S549P probably benign Het
Sap130 T A 18: 31,648,129 probably null Het
Sertad4 C T 1: 192,846,881 S209N probably benign Het
Sez6 A G 11: 77,953,842 T164A probably benign Het
Slc22a28 C T 19: 8,101,473 R284Q probably damaging Het
Slco4c1 T C 1: 96,836,925 K474R probably benign Het
Stx5a T C 19: 8,742,438 S56P probably damaging Het
Svopl T C 6: 38,014,809 T379A probably damaging Het
Sypl2 A G 3: 108,217,692 F118L probably damaging Het
Tfrc G A 16: 32,617,149 V215M probably benign Het
Thnsl2 T C 6: 71,138,668 N185S probably damaging Het
Tmem104 T C 11: 115,243,754 I372T probably damaging Het
Tnfaip6 G A 2: 52,051,058 G204S probably damaging Het
Trim12a C T 7: 104,304,128 E259K probably benign Het
Tubgcp6 G A 15: 89,102,029 R1436C probably benign Het
Tyrp1 C T 4: 80,840,627 L246F probably damaging Het
Ubr4 G T 4: 139,418,406 V216F Het
Unc5a A G 13: 54,999,506 I409V possibly damaging Het
Vmn1r15 T C 6: 57,258,414 L89P probably damaging Het
Vmn1r32 A T 6: 66,553,321 L157* probably null Het
Zcchc24 A G 14: 25,719,761 Y160H probably damaging Het
Zfp184 A T 13: 21,960,206 H694L probably damaging Het
Zfp345 A C 2: 150,472,803 Y271* probably null Het
Zranb3 T C 1: 128,102,934 probably benign Het
Other mutations in Cfap54
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01329:Cfap54 APN 10 93081523 missense unknown
IGL02034:Cfap54 APN 10 93061485 missense probably damaging 0.99
IGL02082:Cfap54 APN 10 93081458 missense unknown
IGL02434:Cfap54 APN 10 93066754 missense probably benign 0.20
R0011:Cfap54 UTSW 10 93065225 missense probably damaging 0.97
R0011:Cfap54 UTSW 10 93065225 missense probably damaging 0.97
R0032:Cfap54 UTSW 10 92932697 missense probably benign 0.04
R0032:Cfap54 UTSW 10 92932697 missense probably benign 0.04
R0040:Cfap54 UTSW 10 92977039 missense probably benign 0.33
R0044:Cfap54 UTSW 10 93035433 missense probably null 0.46
R0086:Cfap54 UTSW 10 93028594 missense possibly damaging 0.86
R0104:Cfap54 UTSW 10 93028652 missense probably damaging 1.00
R0194:Cfap54 UTSW 10 93034662 unclassified probably benign
R0234:Cfap54 UTSW 10 92899160 nonsense probably null
R0308:Cfap54 UTSW 10 92885364 missense unknown
R0332:Cfap54 UTSW 10 93035457 missense probably damaging 1.00
R0409:Cfap54 UTSW 10 92776213 missense probably benign 0.00
R0433:Cfap54 UTSW 10 92979080 splice site probably benign
R0436:Cfap54 UTSW 10 93038975 missense possibly damaging 0.95
R0463:Cfap54 UTSW 10 92874943 critical splice donor site probably null
R0523:Cfap54 UTSW 10 92908883 utr 3 prime probably benign
R0551:Cfap54 UTSW 10 93025122 missense probably benign 0.35
R0595:Cfap54 UTSW 10 92884736 missense unknown
R0617:Cfap54 UTSW 10 92829650 splice site probably benign
R0632:Cfap54 UTSW 10 92885096 missense unknown
R0730:Cfap54 UTSW 10 93034737 missense probably benign 0.05
R0786:Cfap54 UTSW 10 92967535 missense possibly damaging 0.72
R0883:Cfap54 UTSW 10 92870669 missense unknown
R1004:Cfap54 UTSW 10 93066696 splice site probably benign
R1033:Cfap54 UTSW 10 92839449 missense probably benign 0.07
R1168:Cfap54 UTSW 10 92937920 missense probably damaging 0.99
R1186:Cfap54 UTSW 10 92875994 missense unknown
R1429:Cfap54 UTSW 10 92821038 missense probably benign 0.01
R1443:Cfap54 UTSW 10 92932721 missense probably damaging 1.00
R1467:Cfap54 UTSW 10 92969763 missense probably benign 0.01
R1557:Cfap54 UTSW 10 92984227 missense possibly damaging 0.68
R1687:Cfap54 UTSW 10 92932640 missense probably damaging 1.00
R1690:Cfap54 UTSW 10 93035442 missense possibly damaging 0.95
R1711:Cfap54 UTSW 10 93011020 missense possibly damaging 0.86
R1756:Cfap54 UTSW 10 93048061 missense probably damaging 1.00
R1769:Cfap54 UTSW 10 92904263 critical splice donor site probably null
R1835:Cfap54 UTSW 10 92962375 missense probably benign 0.35
R1889:Cfap54 UTSW 10 93034710 missense possibly damaging 0.94
R1915:Cfap54 UTSW 10 92884702 missense unknown
R1958:Cfap54 UTSW 10 92997342 missense probably benign 0.18
R2005:Cfap54 UTSW 10 92884768 missense unknown
R2018:Cfap54 UTSW 10 93016604 missense probably benign 0.00
R2045:Cfap54 UTSW 10 93038809 splice site probably null
R2059:Cfap54 UTSW 10 92942979 unclassified probably benign
R2100:Cfap54 UTSW 10 93001937 missense possibly damaging 0.84
R2110:Cfap54 UTSW 10 92886367 missense unknown
R2392:Cfap54 UTSW 10 93025011 critical splice donor site probably null
R2508:Cfap54 UTSW 10 92997374 missense possibly damaging 0.72
R2852:Cfap54 UTSW 10 92940155 missense probably damaging 1.00
R2857:Cfap54 UTSW 10 93045282 missense probably damaging 0.99
R2871:Cfap54 UTSW 10 92921419 missense possibly damaging 0.86
R2871:Cfap54 UTSW 10 92921419 missense possibly damaging 0.86
R3107:Cfap54 UTSW 10 92994683 missense probably benign 0.04
R3108:Cfap54 UTSW 10 92994683 missense probably benign 0.04
R3157:Cfap54 UTSW 10 92999056 missense probably benign 0.03
R3158:Cfap54 UTSW 10 92999056 missense probably benign 0.03
R3159:Cfap54 UTSW 10 92999056 missense probably benign 0.03
R3161:Cfap54 UTSW 10 93045278 missense probably damaging 1.00
R3162:Cfap54 UTSW 10 93045278 missense probably damaging 1.00
R3162:Cfap54 UTSW 10 93045278 missense probably damaging 1.00
R3508:Cfap54 UTSW 10 92885424 missense unknown
R3730:Cfap54 UTSW 10 93011473 nonsense probably null
R3770:Cfap54 UTSW 10 92878536 missense unknown
R3776:Cfap54 UTSW 10 93045100 missense probably damaging 1.00
R3778:Cfap54 UTSW 10 92904344 utr 3 prime probably benign
R3795:Cfap54 UTSW 10 92942873 unclassified probably benign
R3834:Cfap54 UTSW 10 92801123 splice site probably benign
R3891:Cfap54 UTSW 10 93038846 missense possibly damaging 0.87
R3932:Cfap54 UTSW 10 92829757 missense probably benign 0.03
R3973:Cfap54 UTSW 10 92839471 missense possibly damaging 0.95
R3974:Cfap54 UTSW 10 92839471 missense possibly damaging 0.95
R3976:Cfap54 UTSW 10 92839471 missense possibly damaging 0.95
R3978:Cfap54 UTSW 10 92962412 missense probably benign 0.01
R4190:Cfap54 UTSW 10 92885023 missense unknown
R4389:Cfap54 UTSW 10 92967500 missense probably benign 0.37
R4542:Cfap54 UTSW 10 93025129 missense probably benign 0.12
R4564:Cfap54 UTSW 10 92839540 unclassified probably benign
R4576:Cfap54 UTSW 10 93043228 critical splice donor site probably null
R4620:Cfap54 UTSW 10 92969757 missense probably benign 0.01
R4714:Cfap54 UTSW 10 92815918 missense probably benign 0.01
R4762:Cfap54 UTSW 10 93061453 splice site probably null
R4776:Cfap54 UTSW 10 92972694 missense possibly damaging 0.96
R4819:Cfap54 UTSW 10 92836477 nonsense probably null
R4827:Cfap54 UTSW 10 92902075 utr 3 prime probably benign
R4832:Cfap54 UTSW 10 92967528 missense probably benign 0.01
R4965:Cfap54 UTSW 10 93066799 missense probably benign 0.23
R5001:Cfap54 UTSW 10 92964534 missense probably benign 0.01
R5060:Cfap54 UTSW 10 93039151 missense probably damaging 1.00
R5067:Cfap54 UTSW 10 93066766 missense probably benign 0.17
R5069:Cfap54 UTSW 10 92937774 missense probably benign
R5094:Cfap54 UTSW 10 92898999 utr 3 prime probably benign
R5109:Cfap54 UTSW 10 92937891 missense probably benign 0.03
R5127:Cfap54 UTSW 10 92886387 splice site probably null
R5143:Cfap54 UTSW 10 93029158 missense possibly damaging 0.73
R5147:Cfap54 UTSW 10 92937838 missense probably benign 0.00
R5158:Cfap54 UTSW 10 93065197 missense probably damaging 1.00
R5256:Cfap54 UTSW 10 92935091 nonsense probably null
R5256:Cfap54 UTSW 10 93045023 splice site probably null
R5266:Cfap54 UTSW 10 92815902 missense probably benign 0.16
R5304:Cfap54 UTSW 10 92821106 missense probably damaging 0.97
R5369:Cfap54 UTSW 10 93061257 intron probably benign
R5406:Cfap54 UTSW 10 93001858 missense probably benign 0.33
R5471:Cfap54 UTSW 10 93028660 missense probably damaging 1.00
R5485:Cfap54 UTSW 10 93029117 missense probably damaging 1.00
R5540:Cfap54 UTSW 10 92972608 missense possibly damaging 0.85
R5586:Cfap54 UTSW 10 92972611 nonsense probably null
R5614:Cfap54 UTSW 10 93045049 missense probably damaging 1.00
R5634:Cfap54 UTSW 10 92904263 critical splice donor site probably benign
R5680:Cfap54 UTSW 10 92979017 nonsense probably null
R5797:Cfap54 UTSW 10 92967576 missense probably benign 0.11
R5859:Cfap54 UTSW 10 93016524 nonsense probably null
R5878:Cfap54 UTSW 10 92964561 missense probably benign 0.01
R5910:Cfap54 UTSW 10 93065181 missense probably damaging 0.99
R5936:Cfap54 UTSW 10 92962412 missense probably benign 0.01
R5994:Cfap54 UTSW 10 93039081 missense probably damaging 0.99
R6080:Cfap54 UTSW 10 93045335 missense possibly damaging 0.64
R6268:Cfap54 UTSW 10 93038909 missense probably damaging 1.00
R6296:Cfap54 UTSW 10 93066846 missense probably damaging 1.00
R6409:Cfap54 UTSW 10 92967492 missense probably benign 0.04
R6545:Cfap54 UTSW 10 92836457 missense probably benign 0.31
R6570:Cfap54 UTSW 10 92815958 missense unknown
R6597:Cfap54 UTSW 10 92999040 missense possibly damaging 0.85
R6702:Cfap54 UTSW 10 92868734 missense unknown
R6703:Cfap54 UTSW 10 92868734 missense unknown
R6720:Cfap54 UTSW 10 92821119 missense probably benign 0.07
R6841:Cfap54 UTSW 10 92875015 missense unknown
R6910:Cfap54 UTSW 10 92836512 missense probably benign 0.29
R6953:Cfap54 UTSW 10 92994678 missense probably benign 0.19
R7009:Cfap54 UTSW 10 92875019 missense unknown
R7129:Cfap54 UTSW 10 93016571 missense probably benign 0.06
R7131:Cfap54 UTSW 10 92821104 missense probably benign 0.03
R7171:Cfap54 UTSW 10 92776210 missense probably damaging 0.99
R7189:Cfap54 UTSW 10 92937728 missense unknown
R7225:Cfap54 UTSW 10 92904374 missense unknown
R7270:Cfap54 UTSW 10 92839458 missense probably benign 0.03
R7323:Cfap54 UTSW 10 92801138 missense probably benign 0.00
R7380:Cfap54 UTSW 10 93047978 missense probably damaging 1.00
R7395:Cfap54 UTSW 10 92884703 missense unknown
R7411:Cfap54 UTSW 10 92868755 missense unknown
R7503:Cfap54 UTSW 10 92887436 splice site probably null
R7622:Cfap54 UTSW 10 92956944 missense unknown
R7679:Cfap54 UTSW 10 92967512 missense probably benign 0.01
R7776:Cfap54 UTSW 10 92868741 missense unknown
R7844:Cfap54 UTSW 10 92902058 missense unknown
R7988:Cfap54 UTSW 10 92902079 missense unknown
R8101:Cfap54 UTSW 10 92884796 missense unknown
R8119:Cfap54 UTSW 10 92868810 missense unknown
R8134:Cfap54 UTSW 10 92878516 missense unknown
R8168:Cfap54 UTSW 10 92908877 missense unknown
R8179:Cfap54 UTSW 10 92997316 missense possibly damaging 0.68
R8392:Cfap54 UTSW 10 92962417 missense unknown
R8436:Cfap54 UTSW 10 92964536 missense unknown
R8505:Cfap54 UTSW 10 92978993 missense probably benign 0.03
R8671:Cfap54 UTSW 10 92955072 missense unknown
R8716:Cfap54 UTSW 10 92964632 missense probably benign 0.00
R8816:Cfap54 UTSW 10 92878592 missense unknown
R8822:Cfap54 UTSW 10 93039141 missense probably benign 0.09
R8827:Cfap54 UTSW 10 92938248 missense unknown
X0022:Cfap54 UTSW 10 92878603 missense unknown
X0022:Cfap54 UTSW 10 92932614 missense probably damaging 1.00
X0027:Cfap54 UTSW 10 92878538 missense unknown
X0027:Cfap54 UTSW 10 93001888 missense possibly damaging 0.86
Z1177:Cfap54 UTSW 10 92979026 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGGCTTGATGTAGACACAGTG -3'
(R):5'- TTAGCACTTTTCGCTAGAATGC -3'

Sequencing Primer
(F):5'- GACACAGTGTATAATCCTTAAAGGG -3'
(R):5'- GCTAGAATGCGCTATCAGTGAC -3'
Posted On2020-09-15